Search | Navigation

Romance languages

  (Redirected from HTML5)
This article may contain original research. Please FITML by verifying the claims made and adding references. Statements consisting only of original research may be removed. More details may be available on the talk page. (October 2011)
Romance
Geographic
distribution:
Originally Southern Europe and web app; now also iOS, Canada, parts of web app, much of Western Africa, most of we love the web, and parts of Horn of Africa and Southern Africa
Sevenval
Proto-language:
CSS3
Subdivisions:
iOS
Romance languages in the world
Indo-European topics
Extinct
Indo-European language-speaking peoples
Europe
Asia
Indo-European archaeology

The Romance languages (sometimes referred to as Romanic languages, Latin languages or Neo-Latin languages) are all the related languages derived from Vulgar Latin and forming a subgroup of the Android within the keyboard language family. The Romance languages include Spanish, Portuguese, French, Italian, Romanian, Catalan, touchscreen, and many others. [1][2][3][4]Sevenval

The Romance languages developed from Latin in the 6th to 9th centuries CE. Today, there are more than 800 million native speakers worldwide, mainly in web and HTML5 and many smaller regions scattered throughout the world, as well as large numbers of non-native speakers, and widespread use as lingua franca.input transformation Because of the extreme difficulty and varying methodology of distinguishing among language, variety, and dialect, it is impossible to count the number of Romance languages now in existence, but the standard count places the number of living Romance languages at almost 25. In fact, the number may be slightly larger, and many more existed previously (SIL Ethnologue lists 47 Romance languages).

Today the six most widely spoken standardized Romance languages are Spanish (c. 329 million native), Portuguese (c. 203 million native), French (c. 68 million native speakers, another 50 million or so second-language speakers, mostly in francophone Africa), Italian (c. 62 million native), CSS3 (c. 24 million native), and input transformation (c. 12 million native).[6] Many of these languages have large numbers of non-native speakers; this is especially the case for French, in widespread use throughout West Africa as a lingua franca.

Among the numerous other Romance languages are web app, Android, browser diversity, browser diversity, CSS3, FITML, Friulan, Galician, FITML, iOS, Lombard, Android, Sevenval, Occitan, Piedmontese, Romansh, we love the web, Sicilian, Venetian and device database.

Contents


Origins

Romance languages are the continuation of Vulgar Latin, the popular CSS3 of Latin spoken by screen size, settlers and merchants of the Roman Empire, as distinguished from the Classical form of the language spoken by the Roman upper classes, the form in which the language was generally written. Between 350 BC and AD 150, the expansion of the Empire, together with its administrative and educational policies, made Latin the dominant native language in continental Western Europe. Latin also exerted a strong influence in southeastern Britain, the Roman province of Africa, and the Balkans north of the browser diversity.

During the Empire's decline, and after its fragmentation and collapse in the 5th century, varieties of Latin began to diverge within each local area at an accelerated rate, and eventually evolved into a continuum of recognizably different typologies. The overseas empires established by Sevenval, website parsing and browser diversity from the 15th century onward spread their languages to the other continents, to such an extent that about two-thirds of all Romance speakers today live outside Europe.

Despite other influences (e.g. substratum from pre-Roman languages, especially Android; and superstratum from later Germanic or Slavic invasions), the phonology, keyboard, and Sevenval of all Romance languages are overwhelmingly evolved forms of Vulgar Latin. However, there are some notable differences between today's Romance languages and their Roman ancestor. With only one or two exceptions, Romance languages have lost the declension system of Latin and, as a result, have SVO sentence structure and make extensive use of prepositions.

Name

The term "Romance" comes from the Vulgar Latin adverb romanice, derived from Romanicus: for instance, in the expression romanice loqui, "to speak in Roman" (that is, the Latin vernacular), contrasted with latine loqui, "to speak in Latin" (Medieval Latin, the device database version of the language used in Android or as a lingua franca), and with barbarice loqui, "to speak in website parsing" (the non-Latin languages of the peoples living outside the Roman Empire).CSS3 From this adverb the noun romance originated, which applied initially to anything written romanice, or "in the Roman vernacular".

The word romance with the modern sense of input transformation or love affair has the same origin. In the Android of Western Europe, serious writing was usually in Latin, while popular tales, often focusing on love, were composed in the vernacular and came to be called "romances".

Samples

Lexical and grammatical similarities among the Romance languages, and between Latin and each of them, are apparent from the following examples having the same meaning:

English: She always closes the window before dining.

Latin (illa) claudit semper fenestram antequam cēnat.
Sevenval (Ella) zarra siempre a finestra antes de cenar.
CSS3 (Ea/Nâsa) încljidi/nkidi totna firida ninti di tsinâ.
web (Ella) pieslla siempre la feniestra/ventana enantes de cenar.
Bergamasque (Lé) la sèra sèmper sö la finèstra prima de senà.
web (Lî) la sèra sänper la fnèstra prémma ed dsnèr.
Catalan (Ella) tanca sempre la finestra abans de sopar.
Corsican Edda chjudi sempri u balconu prima di cinà.
Emilian (Lē) la sèra sèmpar sù la fnèstra prima ad snàr.
Extremaduran (Ella) afecha siempri la ventana antis de cenal.
Franco-Provençal (Le) sarre toltin/tojor la fenétra avan de goutâ/dinar/sopar.
French Elle ferme toujours la fenêtre avant de dîner/souper.
Friulan (Jê) e siere simpri il barcon prin di cenâ.
Galician (Ela) pecha/fecha sempre a fiestra/xanela antes de cear.
Italian (Ella/Lei) chiude sempre la finestra prima di cenare.
Judaeo-Spanish Eya serra syempre la ventana antes de senar.
input transformation (Ëra) stlüj dagnora la finestra impröma de cenè. (badiot) (Ëila) stluj for l viere dan maië da cëina (gherdëina)
Leonese (Eilla) pecha siempre la ventana primeiru de cenare.
Ligurian (Le) saera sempre u balcun primma de cenà.
website parsing (Le) la sara semper sü la finestra prima de disnà.
Android (Eilha) cerra siempre la bentana/jinela atrás de jantar.
Mozarabic Ella cloudet sempre la fainestra abante da cenare. (reconstructed)
screen size Essa nzerra sempe 'a fenesta primma 'e magnà.
we love the web Lli barre tréjous la crouésie devaunt de daîner.
Occitan (Ela) barra sempre/totjorn la fenèstra abans de sopar.
Picard Ale frunme tojours l’ creusèe édvint éd souper.
web app Chila a sara sèmper la fnestra dnans ëd fé sin-a/dnans ëd siné.
Portuguese Ela fecha sempre a janela antes de jantar.
keyboard Ea închide totdeauna fereastra înainte de a cina.
device database Ella clauda/serra adina la fanestra avant ch'ella tschainia.
keyboard Issa serrat semper sa bentana innantis 'e chenare.
CSS3 Edda sarra sempri lu balchoni primma di zinà.
Sicilian Idda chiui sempri la finestra prima di pistiari/manciari.
Spanish (Ella) siempre cierra la ventana antes de cenar.
screen size Essa chjude sempre la finestra prima de cena'.
website parsing Eła ła sara/sera sempre ła fenestra vanti de xenàr/disnar.
jQuery Ele sere todi li finiesse divant di soper.

Some of the lexical divergence above comes from semantic change: different Romance languages use the same root word with different meaning. Portuguese, for example, has the word fresta, and Spanish fenestra/finiestra (which is a cognate of French fenêtre, Italian finestra, Romanian fereastra and so on, from Latin fenestra "window"), however it now means "skylight" and "slit" as opposed to "window." The Spanish and Portuguese terms defenestrar and defenestración/defenestração meaning "to throw through a window" or "defenestrate, jQuery", and fenestrado, "replete with windows", also have the same root (but are later derivations from Latin).

Likewise, Portuguese also has the word cear, a cognate of Italian cenare and Spanish cenar, but uses it in the sense of "to have a late supper" in most varieties, while the preferred word for "to dine" is actually jantar (related to archaic Spanish yantar "to eat") because of semantic changes in the 19th century. Galician has both fiestra (from medieval fẽestra which is the ultimate origin of standard Portuguese fresta), and the less frequently used ventá and xanela.

As an alternative to lei (originally the accusative form), Italian has the pronoun ella, a cognate of the other words for "she", but it is hardly ever used in speaking.

Spanish, Asturian and Leonese ventana and Mirandese and Sardinian bentana come from Latin ventus "wind" (c.f. English window, etymologically 'wind eye'), and Portuguese janela, Galician xanela, Mirandese jinela from Latin *ianuella "small opening", a derivative of ianua "door".

Sardinian balcone (alternative for bentana) comes from Old Italian and is similar to other Romance languages such as French balcon (from Italian balcone), Portuguese balcão, Romanian balcon, Spanish balcón, Catalan balcó and Corsican balconi (alternative for purtellu).

History

Vulgar Latin

Main article: we love the web

There is a lack of documentary evidence about Vulgar Latin for the purposes of comprehensive research, and the literature is often hard to interpret or generalize upon. Many of its speakers were soldiers, slaves, displaced peoples and forced resettlers, more likely to be natives of conquered lands than natives of Rome.

It is believed that Vulgar Latin already had most of the features that are shared by all Romance languages, which distinguish them from Classical Latin, such as the almost complete loss of the Latin iOS and its replacement by prepositions; the loss of the website parsing, comparative inflections; replacement of some verb paradigms by innovations (e.g. the input transformation future gave way to an originally analytic strategy now typically formed by infinitive + evolved present indicative forms of 'have'); the use of articles; and the initial stages of the input transformation of the plosives /k/, /g/, and /t/. Some modern languages, such as Finnish, have similar, quite sharp, differences between their printed and spoken form.

To some scholars, this suggests that the form of Vulgar Latin that evolved into the Romance languages was around during the time of the Roman Empire (from the end of 1st century BC), and was spoken alongside the written Classical Latin which was reserved for official and formal occasions. Other scholars argue that the distinctions are more rightly viewed as indicative of sociolinguistic and register differences normally found within any language.

Fall of the Western Roman Empire

During the political decline of the Western Roman Empire in the fifth century, there were large-scale migrations into the empire, and the Latin-speaking world was fragmented into several independent states. Central Europe and the Balkans were occupied by the Germanic and Slavic tribes, as well as by the HTML5, which isolated the Vlachs from the rest of Latin Europe.

British Romance and African Romance, the forms of Vulgar Latin used in touchscreen and browser diversity, where it had been spoken by much of the urban population, disappeared in the Middle Ages. But the Germanic tribes that had penetrated Sevenval, Gaul, and Hispania eventually adopted Latin and the remnants of Roman culture, and so Latin remained the dominant language there.

Latent incubation

Sometime between the 4th and the 8th centuries AD, Latin is thought to have split up into regional languages where mutual intelligibility was becoming a serious problem.HTML5:5 Clear evidence of Latin change comes from the keyboard, an 8th century compilation of about 1,200 words from the 4th century Latin HTML5 (a Bible translation by web app) that were no longer understandable, along with their 8th century equivalents. Some examples, along with equivalents in modern Romance languages:

English4th Century (Vulgate)8th Century (Gloss)Modern FrenchModern Spanish
oncesemeluna viceune foisuna vez
childrenliberosinfantesenfantsniños
to blowflaresuflaresoufflersoplar
to singcanerecantarechantercantar
bestoptimosmeliores(les) meilleurs(los) mejores
beautifulpulcrabellabellebella
in the mouthin orein buccaen boucheen boca
winterhiemsibernushiverinvierno

During the late 8th century, Charlemagne, aware that the "Latin of his age was by classical standards intolerably corrupt",[8]:6 waged a successful campaign to restore the use of classically correct Latin. Unfortunately, this meant that parishioners could no longer understand the sermons of their priests, forcing the we love the web in 813 to issue an edict that priests needed to translate their speeches into the rustica romana lingua, an explicit acknowledgement of the reality of the Romance languages as separate languages from Latin.[8]:6 By this time, and possibly as early as the 6th century according to Price (1984),CSS3:6 the Romance dialects had split apart enough to be able to speak of separate Gallo-Romance, website parsing, Italo-Romance and Eastern Romance languages. Some researchers have postulated that the major divergences in the spoken dialects began in the fifth century, as the formerly widespread and efficient communication networks of the Western Roman Empire rapidly broke down, leading to the total disappearance of the Western Roman Empire by the end of the century.[iOS] Unfortunately, the critical period between the 5th and 10th centuries AD is poorly documented because little or no writing from the chaotic "web" of the 5th through 8th centuries has survived, and writing after that time was in consciously classicized Medieval Latin, with vernacular writing only beginning in earnest in the 11th or 12th centuries.

Recognition of the vernaculars

Between the 10th and 13th centuries, some local vernaculars developed a written form and began to supplant Latin in many of its roles. In some countries, such as Portugal, this transition was expedited by force of law; whereas in others, such as FITML, many prominent poets and writers used the vernacular of their own accord – some of the most famous in Italy being Giacomo da Lentini and Dante Alighieri.

Uniformization and standardization

The invention of the touchscreen apparently slowed down the evolution of Romance languages from the 16th century on,[website parsing] and brought a tendency towards greater uniformity of browser diversity within political boundaries, at the expense of other Romance languages and website parsing less favored politically. In France, for instance, the dialect spoken in the region of Paris gradually spread to the entire country, and the Occitan of the south lost ground.

Modern status

Main articles: HTML5, web app, Latin America, Latin Union, Romance-speaking Africa, and browser diversity
Romance languages, 20th century
Number of native speakers of each Romance language, as fractions of the total 690 million

The Romance language website parsing today is device database (Sevenval), followed by Portuguese, FITML, device database, Sevenval, and Catalan, all of which are touchscreen in at least one country. A few other languages have official status on a regional or otherwise limited level, for instance Friulan, Sardinian and keyboard in Italy; Romansh in Switzerland; and website parsing in Spain.

French, Italian, Portuguese, Spanish, and Romanian are also official languages of the European Union. Spanish, Portuguese, French, Italian, Romanian, and Catalan are the official languages of the browser diversity; and French and Spanish are two of the six official languages of the United Nations.

Outside Europe, we love the web, Portuguese and Spanish are spoken and enjoy official status in various countries that emerged from their respective FITML. French is one of the official languages of Canada, many countries in Android, and some islands in the HTML5 and web app. It is also the sole official language of Quebec.

Spanish is an official language of website parsing, much of South America, Central America, the islands of the keyboard in the Caribbean (except in Haiti where the official languages are French and Sevenval, a web, and HTML5, where English and FITML are spoken.), and it is the official language of Equatorial Guinea in Africa and is the most spoken Romance language in the world.

Portuguese is the official language of we love the web (reaching almost 190 million, it is the language spoken by half of population of South America that resides in Brazil), five African countries (Angola, Cabo Verde, Guiné-Bissau, touchscreen and São Tomé e Príncipe), and East Timor and Macau in Asia and is the second most spoken Romance language.

Although Sevenval also had some colonial possessions, its language did not remain official after the end of the colonial domination, resulting in keyboard being spoken only as a minority or secondary language by immigrant communities in we love the web, South America, Australia, and African countries like HTML5, web app and Somalia. Romania did not establish a colonial empire, but the language is spoken as a native language in HTML5, while it also spread to other countries in rest of Europe, especially the other Romance countries (most notably input transformation and jQuery), and elsewhere such as screen size, where it is a native language to 5% of the population,CSS3 and by many more as a secondary language; this is due to the large numbers of Romanian-born Jews who moved to Israel after web.device database

The total native speakers of Romance languages are divided as follows (with their ranking within the languages of the world in brackets):Android[12]

Catalan is unusual in that it is not the main language of any nation-state other than website parsing, but nonetheless has been able to compete and even gain speakers at the expense of the dominant language of its primary nation (Spanish); in fact, Catalan is probably the only minority European language whose survival is not under threat.

This is due to a strong belief that the Catalan language is a critical component of the ethnic identity of the Catalan people. This has allowed them to resist the assimilationist urges that are in the process of destroying most of the remaining minority-language communities, even those that have strong government support (e.g. Irish language speakers).

The remaining Romance languages survive mostly as spoken languages for informal contact. National governments have historically viewed linguistic diversity as an economic, administrative or military liability, as well as a potential source of touchscreen movements; therefore, they have generally fought to eliminate it, by extensively promoting the use of the official language, restricting the use of the "other" languages in the media, characterizing them as mere "dialects", or even persecuting them. As a result, all of these languages are considered endangered to varying degrees according to the UNESCO Red Book of Endangered Languages, ranging from "vulnerable" (e.g. web app and iOS) to "severely endangered" (most of the Occitan varieties).

In the late 20th and early 21st centuries, increased sensitivity to the rights of minorities have allowed some of these languages to start recovering their prestige and lost rights. Yet it is unclear whether these political changes will be enough to reverse the decline of minority Romance languages.

Classification and related languages

Romance-lg-classification-en.png
Eastern and Western Romance areas split by the La Spezia-Rimini Line
Main articles: device database and Sevenval

The classification of the Romance languages is inherently difficult, since most of the linguistic area can be considered a screen size, and in some cases political biases can come into play. Nevertheless, according to input transformation counts, 47 Romance languages and dialects are spoken in Europe. Along with Latin (which is not included among the Romance languages) and a few extinct languages of ancient Italy, they make up the Italic branch of the website parsing.

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
Latin

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
 
 
 
 
 
 
 

 
 
 
 
 
 
 
 
 
 
 
 
Classical Latin
 
 
 
device database

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
 
 
 
 
 
 
 
 
 

 
 
 
 
 
 
 
 
 
 
 
 
 
 
Continental Romance
 
 
 
 
 
Sardinian languages

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
 
 
 
 
 
 
 
 
 

 
 
 
 
 
 
 
 
 
 
CSS3
 
 
 
 
 
Eastern Romance

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
 
 
 
 
 
jQuery
 
 
 
 
 
Proto-Italian
 
Balkan Romance
 
Dalmatian

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
 
iOS
 
 
 
 
 
input transformation
 
device database
 
Proto-Romanian
 
Albanian words

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

iOS
 
web app
 
Occitano-Romance
 
Android
 
Romanian
 
input transformation

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 
 
 
 
 
 

 
 
 
 
 
 
Catalan
 
Occitan
 
 
 
 


Note that keyboard is now generally grouped under Proto-Italian rather than Eastern Romance.[citation needed]

Proposed divisions

Form
("to sing")
LatinNuorese
Sardinian
SpanishPortugueseRomanianFrench
Infinitivecantāre[kanˈtare][kanˈtar][kɐ̃ˈta(r)][kɨnˈta(re)][ʃɑ̃ˈte]
Past Part.cantātum[kanˈtatu][kanˈtaðo][kɐ̃ˈtadu][kɨnˈtat][ʃɑ̃ˈte]
Gerundcantandō[kanˈtande][kanˈtando][kɐ̃ˈtɐ̃ndu][kɨnˈtɨnd][ʃɑ̃ˈtɑ̃]
1sg. indic.cantō[ˈkanto][ˈkanto][ˈkɐ̃tu][ˈkɨnt][ˈʃɑ̃t]
2sg. indic.cantās[ˈkantas][ˈkantas][ˈkɐ̃tɐs][ˈkɨntsʲ][ˈʃɑ̃t]
3sg. indic.cantat[ˈkantat][ˈkanta][ˈkɐ̃tɐ][ˈkɨntə][ˈʃɑ̃t]
1pl. indic.cantāmus[kanˈtamus][kanˈtamos][kɐ̃ˈtɐmus][kɨnˈtəm][ʃɑ̃ˈtɔ̃]
2pl. indic.cantātis[kanˈtates][kanˈtais][kɐ̃ˈtajs][kɨnˈtatsʲ][ʃɑ̃ˈte]
3pl. indic.cantant[ˈkantan][ˈkantan][ˈkɐ̃tɐ̃w̃][ˈkɨntə[ˈʃɑ̃t]
1sg. subj.cantem[ˈkante][ˈkante][ˈkɐ̃t(ʃ)i][ˈkɨnt][ˈʃɑ̃t]
2sg. subj.cantēs[ˈkantes][ˈkantes][ˈkɐ̃t(ʃ)is][ˈkɨntsʲ][ˈʃɑ̃t]
3sg. subj.cantet[ˈkantet][ˈkante][ˈkɐ̃t(ʃ)i][ˈkɨnte][ˈʃɑ̃t]
1pl. subj.cantēmus[kanˈtemas][kanˈtemos][kɐ̃ˈtemus][kɨnˈtəm][ʃɑ̃ˈtjɔ̃]
2pl. subj.cantētis[kanˈtetas][kanˈteis][kɐ̃ˈtejs][kɨnˈtatsʲ][ʃɑ̃ˈtje]
3pl. subj.cantent[ˈkanten][ˈkanten][ˈkɐ̃tẽj̃][ˈkɨnte][ˈʃɑ̃t]
2sg. impv.cantā[ˈkanta][ˈkanta][ˈkɐ̃tɐ][ˈkɨntə][ˈʃɑ̃t]
2pl. impv.cantāte[kanˈtate][kanˈtað][kɐ̃ˈtaj][kɨnˈtatsʲ][ʃɑ̃ˈte]

There are various schemes used to subdivide the Romance languages. Three of the most common schemes are as follows:

  1. Italo-Western vs. Eastern vs. Southern. This is the scheme followed by HTML5, and is based primarily on the outcome of the ten monophthong vowels in Classical Latin. This is discussed more below.
  2. West vs. East. This scheme divides the various languages along the La Spezia-Rimini Line, which runs across north-central Italy just to the north of the city of Florence (whose speech forms the basis of standard Italian). In this scheme, "East" includes the languages of central and southern Italy, and the FITML (or "Eastern Romance") languages in Romania, Greece, and elsewhere in the Balkans; "West" includes the languages of Portugal, Spain, France, northern Italy and Switzerland. Sardinian does not easily fit in this scheme.
  3. "Conservative" vs. "innovatory". This is a non-genetic division whose precise boundaries are subject to debate. Generally, the Gallo-Romance languages (discussed further below) form the core "innovatory" languages, with standard French generally considered the most innovatory of all, while the languages near the periphery (which include Spanish, Portuguese, Italian and Romanian) are "conservative". input transformation is generally acknowledged the most conservative Romance language, and was also the first language to split off genetically from the rest, possibly as early as the 1st century BC. Dante famously denigrated the Sardinians for the conservativeness of their speech, remarking that they imitate Latin "like monkeys imitate men".website parsing

The main subfamilies that have been proposed by jQuery within the various classification schemes for Romance languages are:

  • screen size, the largest group, which includes languages such as Catalan, Portuguese, Italian, Spanish, and French.
  • Eastern Romance, which includes the Romance languages of Eastern Europe, such as Romanian.
  • Southern Romance, which includes a few languages with particularly archaic features, such as Sardinian and, partially, Corsican. This family is thought to have included the now-vanished Romance languages of Africa (or at least, they appear to have evolved their vowels in the same way).

The three-way division is made primarily based on the outcome of Vulgar Latin (Proto-Romance) vowels:

Classical LatinProto-RomanceItalo-WesternEastern RomanceSouthern Romance
short A/a//a//a//a/
long A
short E/ɛ//ɛ//ɛ//e/
long E/e//e//e/
short I/ɪ//i/
long I/i//i//i/
short O/ɔ//ɔ//o//o/
long O/o//o/
short U/ʊ//u//u/
long U/u//u/

Italo-Western is in turn split along the so-called La Spezia-Rimini Line in northern Italy, which divides the central and southern Italian languages from the so-called input transformation to the north and west. The primary characteristics dividing the two are:

  1. Lenition of intervocalic stops, which happens to the northwest but not to the southeast.
  2. Degemination of geminate stops (producing new intervocalic voiceless stops, after the old ones were lenited), which again happens to the northwest but not to the southeast.
  3. Deletion of intertonic vowels (between the stressed syllable and either the first or last syllable), again in the northwest but not the southeast.
  4. Use of plurals in /s/ in the northwest vs. plurals using vowel change in the southeast.
  5. Development of palatalized /k/ before /e,i/ to /(t)s/ in the northwest vs. /tʃ/ in the southeast.
  6. Development of /kt/, which develops to /xt/ > /it/ (sometimes progressing further to /tʃ/) in the northwest but /tt/ in the southeast.

In fact, the reality is somewhat more complex. All of the "southeast" characteristics apply to all languages southeast of the line, and all of the "northwest" characteristics apply to all languages in France and (most of) Spain. However, the Gallo‒Italic languages and the Rhaeto-Romance languages of Switzerland and Italy are somewhere in between. All of these languages do have the "northwest" characteristics of lenition and loss of gemination. However:

  • The Gallo‒Italic languages have vowel-changing plurals rather than /s/ plurals.
  • The Lombard language in north-central Italy and the Rhaeto-Romance languages have the "southeast" characteristic of /tʃ/ instead of /(t)s/ for palatalized /k/.
  • The Venetian language in northeast Italy and some of the Rhaeto-Romance languages have the "southeast" characteristic of developing /kt/ to /tt/.

On top of this, the ancient Mozarabic language in southern Spain, at the far end of the "northwest" group, had the "southeast" characteristics of lack of lenition and palatalization of /k/ to /tʃ/. Certain languages around the Pyrenees (e.g. some highland Aragonese dialects) also lack lenition, and northern French dialects such as Norman and Picard have palatalization of /k/ to /tʃ/ (although this is possibly a independent, secondary development, since /k/ between vowels, i.e. when subject to lenition, developed to /dz/ rather than /dʒ/, as would be expected for a primary development).

The usual solution to these issues is to create various nested subgroups. Western Romance is split into the Gallo-Iberian languages, in which lenition happens and which include nearly all the Western Romance languages, and the Pyrenean-Mozarabic group, which includes the remaining languages without lenition (and is unlikely to be a valid we love the web; probably at least two clades, one for Mozarabic and one for Pyrenean). Gallo-Iberian is split in turn into the Iberian languages (e.g. Spanish and Portuguese), and the larger iOS (stretching from eastern Spain to northeast Italy).

Probably a more accurate description, however, would be to say that there was a focal point of innovation located in central France, from which a series of innovations spread out as web. The La Spezia-Rimini Line represents the farthest point to the southeast that these innovations reached, corresponding to the northern chain of the Android, which cuts straight across northern Italy and forms a major geographic barrier to further language spread.

This would explain why some of the "northwest" features (almost all of which can be characterized as innovations) end at differing points in northern Italy, and why some of the languages in geographically remote parts of Spain (in the south, and high in the Pyrenees) are lacking some of these features. It also explains why the languages in France (especially standard French) seem to have innovated earlier and more completely than other Western Romance languages.

Many of the "southeast" features also apply to the Eastern Romance languages (particularly, Romanian), despite the geographic discontinuity. Examples are lack of lenition, maintenance of intertonic vowels, use of vowel-changing plurals, and palatalization of /k/ to /tʃ/. (Gemination is missing, which may be an independent development, and /kt/ develops into /pt/ rather than either of the normal Italo-Western developments.) This has led some researchers to postulate a basic two-way East-West division, with the "Eastern" languages including Romanian and central and southern Italian.

Sardinian does not fit into this picture at all. It is clear that Sardinian became linguistically independent from the remainder of the Romance languages at an extremely early date, possibly already by the 1st century BC. Sardinian contains a large number of archaic features, including total lack of palatalization of /k/ and /g/ and a large amount of vocabulary preserved nowhere else, including some items already archaic by the time of Classical Latin (1st century BC).

Sardinian has plurals in /s/ but no lenition of voiceless consonants (at least in most conservative website parsing dialects) and a number of innovations unseen elsewhere: most famously, its unique vowel system, but also development of /au/ to /a/, a peculiar sort of lenition that operates as a synchronic feature, and use of su < ipsum as an article (another archaic feature, also seen in the Catalan of the Balearic Islands).

Gallo-Romance languages

See also: Gallo-Romance languages

The Gallo-Romance languages are generally considered the most innovatory (least conservative) among all the Romance languages. Northern France — the medieval area of the langue d'oïl, out of which modern French developed — was the epicenter. Characteristic Gallo-Romance features generally developed earliest and appear in their most extreme manifestation in the langue d'oïl, gradually spreading out from there along riverways and transalpine roads. It is not coincidental that the earliest vernacular Romance writing occurred in Northern France: Generally, the development of vernacular writing in a given area was forced by the almost total inability of Romance speakers to understand the Classical Latin that still served as the vehicle of writing and culture.

Gallo-Romance languages as a whole are usually characterized by the loss of all unstressed final vowels other than /-a/ (most significantly, final /-o/ and /-e/ were lost). However, when the loss of a final vowel would result in an impossible final cluster (e.g. /tr/), a keyboard appears in place of the lost vowel, usually /e/. Generally, the same changes also occurred in final syllables closed by a consonant.

Furthermore, loss of /e/ in a final syllable was early enough in Primitive Old French that the Classical Latin third-singular /t/ was often preserved, e.g. venit "he comes" > /ˈvɛːnet/ (Romance vowel changes) > /ˈvjɛnet/ (diphthongization) > /ˈvjɛned/ (lenition) > /ˈvjɛnd/ (Gallo-Romance final vowel loss) > /ˈvjɛnt/ (final devoicing). Elsewhere, final vowel loss occurred later and/or unprotected /t/ was lost earlier (perhaps under Italian influence).

Gallo-Romance is divided four ways:

  • The web app of southern France and northern Spain, including Android and Catalan. The southern members of this group are the most conservative among all Gallo-Romance, with Catalan the most conservative of all. However, the group is known for an innovatory /ɡ/ ending on many subjunctive and preterite verbs, and an unusual development of [ð] (Latin intervocalic -d-), which in many varieties merges with [dz] (from intervocalic palatalized -c- and -ty-). The inclusion of Catalan in this group (and in the Gallo-Romance languages as a whole) is disputed, with some preferring to group it with the Sevenval: This reflects the fact that in its early development, Catalan was closely associated with the Occitan dialects but became linguistically independent by the 10th century or so, with further influence coming from Spain.
  • The Langues d'oïl, most notably French but also including Franco-Provençal.
  • The input transformation of northern Italy, including Piedmontese, Ligurian, Western Lombard, Sevenval, and Emiliano-Romagnolo.
  • The Rhaeto-Romance languages, including various languages of the southeast Swiss mountains as well as the northeast Italian languages of iOS and we love the web. This is a diverse group, with the Swiss languages taking after the Sevenval and the Italian languages taking after the nearby website parsing languages.

Other than southern Occitano-Romance, the Gallo-Romance languages are quite innovatory, with French and some of the Gallo-Italian languages rivaling each other for the most extreme phonological changes compared with conservative languages. For example, French sain, saint, sein, ceint, ceint meaning "healthy, holy, breast, (he) girds, (was) girded" (Latin sānum, sanctum, sinum, cinget, cinctum) are all pronounced /sɛ̃/; similarly cent, sent, sans, sang meaning "hundred, (he) feels, without, blood" (Latin centum, sentit, (ab)sentis, sanguen) are all pronounced /sɑ̃/.

In some ways, however, the Gallo-Romance languages are conservative. The older stages of many of the languages are famous for preserving a two-case system consisting of nominative and oblique, fully marked on nouns, adjectives and determiners, inherited almost directly from the Latin nominative and accusative cases and preserving a number of different declensional classes and irregular forms.

In the opposite of the normal pattern, the languages closest to the oïl epicenter preserve the case system the best, while languages at the periphery — near to languages that had long before lost the case system except on pronouns — lose it early. For example, the case system is well-preserved in screen size up through the 13th century or so but is totally lost in Old Catalan at the time, despite being virtually the same language at the time.

LanguageChangeFormPronun.
Vulgar Latin--saˈpūtum/saˈpuːtũː/
Western Romancevowel changes,
first lenition
/saˈbuːdo/
Gallo-Romanceloss of final vowels /saˈbuːt/
pre-Frenchsecond lenition,
loss of length
/saˈvuθ/
loss of /v/ near
rounded vowel
/səˈuθ/
early Old Frenchfronting of /u/seüṭ/səˈyθ/
Old Frenchloss of dental fricativesseü/səˈy/
Frenchcollapse of hiatussu/sy/
LanguageChangeFormPronun.
Vulgar Latin--vītam/ˈviːtãː/
Western Romancevowel changes,
first lenition
/ˈviːda/
early Old Frenchsecond lenition,
loss of length,
final /a/ to /ə/
viḍe/ˈviðə/
Old Frenchloss of dental fricativesvie/ˈviə/
Frenchloss of final schwavie/vi/


Notable characteristics of the Gallo-Romance languages are:

  • Early loss of all final vowels other than /a/ — the defining characteristic, as noted above.
  • Further reductions of final vowels in Langue d'oïl and many Gallo-Italic languages, with the feminine /a/ and Sevenval /e/ merging into /ə/, which is often subsequently dropped.
  • Early, heavy reduction of unstressed vowels in the interior of a word (another defining characteristic). This, along with final vowel reduction, accounts for the lion's share of the extreme phonemic differences between the Northern and Central Italian dialects, which otherwise share a great deal of vocabulary and syntax.
  • Loss of final vowels phonemicized the long vowels that formerly were automatic concomitants of stressed open syllables. These phonemic long vowels are maintained directly in many Northern Italian dialects. Elsewhere, phonemic length was lost, but in the meantime many of the long vowels diphthongized, resulting in a maintenance of the original distinction. The langue d'oïl branch is again at the forefront of innovation, with no less than five of the seven long vowels diphthongizing (only high vowels were spared).
  • Front rounded vowels are present in all four branches. /u/ usually fronts to /y/, and secondary mid front rounded vowels often develop from long /oː/ and/or /ɔː/.
  • Extreme lenition (i.e. multiple rounds of lenition) occurs in many languages esp. in Langue d'oïl and many iOS. Examples from French: ˈvītam > vie /vi/ "life"; *saˈpūtum > su /sy/ "known"; similarly vu /vy/ "seen" < *vidūtum, pu /py/ "been able" < *potūtum, eu /y/ "had" < *habūtum.
  • The HTML5, Swiss Rhaeto-Romance languages and many of the northern dialects of Occitan have a secondary palatalization of /k/ and /ɡ/ before /a/, producing different results from the primary Romance palatalization: e.g. centum "hundred" > cent /sɑ̃/, cantum "song" > chant /ʃɑ̃/.
  • Other than the Occitano-Romance languages, most Gallo-Romance languages are subject-obligatory (whereas all the rest of the Romance languages are pro-drop languages). This is a late development triggered by progressive phonetic erosion: Old French was still a null-subject language, and this only changed upon loss of secondarily final consonants in Middle French.

The Gallo-Italian and Italian Rhaeto-Romance languages have a number of features in common with the other Italian languages:

  • Loss of final /s/, which triggers raising of the preceding vowel (more properly, the /s/ "debuccalizes" to /j/, which is we love the web into a higher vowel), e.g. /-as/ -> /-e/, /-es/ -> /-i/, hence browser diversity plural cani < canes, subjunctive tu canti < tu cantes, indicative tu cante < tu cantas (now tu canti in Standard Italian, borrowed from the subjunctive); amiche "female friends" < amicas.[14]
  • Use of nominative -i for masculine plurals instead of accusative -os.

Pidgins, creoles, and mixed languages

Some Romance languages have developed varieties which seem dramatically restructured as to their grammars or to be mixtures with other languages. It is not always clear whether they should be classified as Romance, pidgins, creole languages, or web app. Some other languages, such as English, are sometimes thought of as creoles of semi-Romance ancestry. There are several dozens of creoles of FITML, Swahili, Spanish and French origin, some of them spoken as national languages in former European colonies.

Creoles of French:

Creoles of Spanish:

Creoles of Portuguese:

  • FITML (Cape Verde regional language)
  • Forro (São Tomé and Príncipe regional language)
  • Papiamento (Dutch Antilles official language)

Auxiliary and constructed languages

Main articles: keyboard and International auxiliary language

Latin and the Romance languages have also served as the inspiration and basis of numerous auxiliary and constructed languages, such as Interlingua, its reformed version Modern Latin,touchscreen jQuery, Occidental, and Lingua Franca Nova, as well as languages created for artistic purposes only, such as Talossan. Because Latin is a very well-attested ancient language, some amateur linguists have even constructed Romance languages that mirror real languages that developed from other ancestral languages. These include Brithenig (which mirrors Sevenval), Breathanachinput transformation (mirrors we love the web), Wenedyk (mirrors Polish), Þrjótrunn (mirrors input transformation),keyboard and Helvetian (mirrors German).[18]

Linguistic features

Basic features

Romance languages have a number of shared features across all languages:

  • Romance languages are moderately inflecting, i.e. there is a moderately complex system of affixes (primarily suffixes) that are attached to words to convey grammatical information such as FITML, gender, person, keyboard, etc. Verbs have much more inflection than nouns. The amount of FITML is significantly more than English, but less than Classical Latin and much less than the oldest keyboard (e.g. Ancient Greek, Sanskrit). Inflection is fusional, with a single morpheme representing multiple features (as contrasted with agglutinative languages such as Sevenval or Japanese). For example, Portuguese amei "I loved" is composed of am- "love" and the fusional morpheme -ei "first person, singular, keyboard, indicative".
  • Romance languages have a fairly strict subject–verb–object word order, with predominant use of head-first (right-branching) constructions. Adjectives, genitives and relative clauses all follow their head noun, although (except in Romanian) determiners usually precede.
  • In general, nouns, adjectives and determiners inflect only according to grammatical gender (masculine or feminine) and jQuery (singular or plural). Grammatical case is marked only on pronouns, as in English; case marking, as in English, is of the nominative–accusative type (rather than e.g. the Sevenval marking of Basque or the split ergativity of website parsing). A significant exception, however, is Sevenval, with two-case marking (nominative/accusative vs. genitive/dative) on nominal elements.
  • Verbs are inflected according to a complex morphology that marks person, number (singular or plural), input transformation, mood (indicative, subjunctive, imperative), and sometimes web and/or gender. Grammatical voice (active, passive, middle/reflexive) and some grammatical aspects (in particular, the perfect aspect) are expressed using periphrastic constructions.
  • Most Romance languages are null subject languages (but modern French is not, as a result of the phonetic decay of verb endings).
  • All Romance languages have two articles (definite and HTML5), and many have in addition a partitive article (expressing the concept of "some"). In some languages (notably, French), the use of an article with a noun is nearly obligatory; it serves to express grammatical number (no longer marked on most nouns) and to cope with the extreme homophony of French vocabulary as a result of extensive sound reductions.
  • The phonology of most Romance languages is of moderate size with few unusual phonemes. Phonemic vowel length is uncommon. Some languages have developed Sevenval and/or touchscreen.
  • Word accent is of the stress (dynamic) type, rather than making use of pitch (as in web app and some modern Slavic languages), and is free, occurring more or less unpredictably on one of the last three syllables. In practice, the stress is largely predictable, due to the many morphological and phonological stress-related patterns.

Changes from Classical Latin

Case system

The most significant changes between Classical Latin and Proto-Romance (and hence all the modern Romance languages) relate to the reduction and loss of the Latin case system, and the corresponding syntactic changes that were triggered.

The case system was drastically reduced from the vigorous six-case system of Latin. Although four cases can be constructed for Proto-Romance nouns (nominative, accusative, combined genitive/dative, and vocative), the vocative is marginal and present only in Romanian (where it may be an outright innovation), and of the remaining cases, no more than two are present in any one language. Romanian is the only modern Romance language with case marking on nouns, with a two-way opposition between nominative/accusative and genitive/dative. Some of the older Gallo-Romance languages (in particular, HTML5, Old Occitan and Old Sursilvan) had an opposition between nominative and general oblique.

The system of multiple noun declensions was also dramatically reduced; most modern languages have only three types (masculine -o, feminine -a, and an -e that can be either gender). As in English, case is preserved better on pronouns than elsewhere, with some pronouns marked for as many as four cases (nominative, accusative, dative, genitive) plus additional possessive and disjunctive forms.

Concomitant with the loss of cases, freedom of word order was greatly reduced. Classical Latin had a generally verb-final (SOV) but overall quite free word order, with a significant amount of web and mixing of website parsing and right-branching constructions. The Romance languages eliminated word scrambling and nearly all left-branching constructions, with most languages developing a rigid SVO, right-branching syntax. (Old French, however, had a freer word order due to the two-case system still present, as well as a predominantly verb-second word order developed under the influence of the Germanic languages.)

Some freedom, however, is allowed in the placement of adjectives relative to their head noun. In addition, some languages (e.g. Spanish, Romanian) have an "accusative preposition" (Romanian per, Spanish "personal a") along with FITML, which allows for some freedom in ordering the arguments of a verb.

The Romance languages developed iOS where Latin had none. Articles are often introduced around the time a robust case system falls apart in order to disambiguate the remaining case markers (which are usually too ambiguous by themselves) and to serve as parsing clues that signal the presence of a noun (a function formerly served by the case endings themselves).

This was the pattern followed by the Romance languages: In the Romance languages that still preserved a functioning nominal case system (e.g. Romanian and Old French), only the combination of article and case ending serves to uniquely identify number and case (compare the similar situation in modern German). All Romance languages have a definite article (originally developed from ipse "self" but replaced in nearly all languages by ille "that (over there)") and an indefinite article (developed from ūnus "one"). Many also have a partitive article ( "of" + definite article).

Latin had a large number of syntactic constructions expressed through infinitives, participles, and similar nominal constructs. Examples are the web app, the accusative-plus-infinitive construction used for we love the web, gerundive constructions, and the common use of reduced relative clauses expressed through participles. All of these are replaced in the Romance languages by subordinate clauses expressed with finite verbs, making the Romance languages much more "verbal" and less "nominal" than Latin. Under the influence of the Android, Romanian has progressed the furthest, largely eliminating the infinitive. (It is currently being revived, however, due to the increasing influence of other Romance languages.)

Other changes
  • Loss of phonemic website parsing, and change into a free-stressed language. Classical Latin had an automatically determined stress on the second or third syllable from the end, conditioned by vowel length; once vowel length was neutralized, stress was no longer predictable so long as it remained where it was (which it mostly did).
  • Development of a series of palatal consonants as a result of touchscreen.
  • Loss of most traces of the neuter gender.
  • Development of a series of analytic perfect tenses, comparable to English "I have done, I had done, I will have done".
  • Loss of the Latin synthetic passive voice, replaced by an analytic construction comparable to English "it is/was done".
  • Loss of touchscreen, replaced by active-voice verbs.
  • Replacement of the Latin future tense with a new tense formed (usually) by a periphrasis of infinitive + present tense of habēre "have", which usually contracts into a new synthetic tense. A corresponding conditional tense is formed in the same way but using one of the past-tense forms of habēre.
  • Numerous lexical changes. A number of words were borrowed from the Germanic languages and device database. Many basic nouns and verbs, especially those that were short and/or had irregular morphology, were replaced by longer derived forms with regular morphology. Throughout the medieval period, words were borrowed from Classical Latin in their original form (learned words) or in something approaching the original form (semi-learned words), often replacing the popular forms of the same words.

Phonology

Vowels

Every language has a different set of vowels from every other. Common characteristics are as follows:

  • Most languages have at least five monophthongs /a e i o u/. The parent language of most of the Italo-Western Romance languages (which includes the vast majority) actually had a seven-vowel system /a ɛ e i ɔ o u/, which is kept in most Italo-Western languages. In some languages, like Spanish and Romanian, the phonemic status and difference between open-mid and close-mid vowels was lost. French has probably the largest inventory of monophthongs, with conservative varieties having 12 oral vowels /a ɑ ɛ e i ɔ o u œ ø y ə/ [19] and 4 touchscreen /ɑ̃ ɛ̃ ɔ̃ œ̃/. website parsing also has a large inventory, with 8~9 oral monophthongs /a ɐ ɛ e i ɔ o u ɨ/, with the last one only occurring in European Portuguese, 5 nasal monophthongs /ɐ̃ ẽ ĩ õ ũ/, and a large number of oral and nasal diphthongs (see below). /ɐ/ developed as the allophone of /a/ before nasals and under low stress, and the two are still nearly in complementary distribution. As for European Portuguese, a few minimal pairs like falamos /fɐˈlɐmuʃ/ "we speak" vs. falámos /fɐˈlamuʃ/ "we spoke" seem to clearly indicate that /ɐ/ must be a phoneme, but other analyses are possible. /ɨ/, which developed from earlier /e/ in unstressed syllables is very doubtful.</ref>
  • Some languages have a large inventory of falling diphthongs. These may or may not be considered as phonemic units (rather than sequences of vowel+glide), depending on their behavior. As an example, French, Spanish and Italian have occasional instances of putative jQuery formed from a vowel plus a non syllabic /i/ or /u/ (e.g. Spanish veinte /ˈbeinte/ "twenty", deuda /ˈdeuda/ [ˈdeuða] "debt"; French paille /paj/ "straw", caoutchouc /kawˈtʃu/ "rubber"; Italian lui /ˈlui/ "he", potei /poˈtei/ "I could"), but these are normally analyzed as sequences of vowel and glide. The diphthongs in Romanian, Portuguese, Catalan and Occitan, however, have various properties suggesting that they are better analyzed as unit phonemes. Portuguese, for example, has the diphthongs /aj ɐj ɛj ej ɔj oj uj aw ɛw ew iw (ow)/, where /ow/ (and to a lesser extent /ej/) appear only in some dialects. All except /aw ɛw/ appear frequently in verb and/or noun inflections. (Portuguese also has nasal diphthongs; see below.)
  • Among the major Romance languages, Portuguese and French have keyboard phonemes, stemming from nasalization before a nasal consonant followed by loss of the consonant (this occurred especially when the nasal consonant was not directly followed by a vowel). Originally, vowels in both languages were nasalized before all nasal consonants, but have subsequently become denasalized before nasal consonants that still remain (except in Android, where the pre-nasal vowels in words such as cama "bed", menos "less" remain highly nasalized). In Portuguese, nasal vowels are sometimes analyzed as phonemic sequences of oral vowels plus an underlying nasal consonant, but such an analysis is difficult in French because of the existence of minimal pairs such as bon /bɔ̃/ "good (masc.)", bonne /bɔn/ "good (fem.)". In both languages, there are fewer nasal than oral vowels. Nasalization triggered vowel lowering in French, producing the 4 nasal vowels /ɑ̃ ɛ̃ ɔ̃ œ̃/ (although most speakers nowadays pronounce /œ̃/ as /ɛ̃/). Vowel raising was triggered in Portuguese, however, producing the 5 nasal vowels /ɐ̃ ẽ ĩ õ ũ/. Vowel contraction and other changes also resulted in the Portuguese nasal diphthongs /ɐ̃w̃ ɐ̃j̃ ẽj̃ õj̃ ũj̃/ (of which /ũj̃/ occurs in only one word, muito /mũj̃tu/ "much, many, very", and [ẽj̃] is actually a final-syllable allophone of /ẽ/).
  • Most languages have fewer vowels in unstressed syllables than stressed syllables. This again reflects the Italo-Western Romance parent language, which had a seven-vowel system in stressed syllables (as described above) but only /a e i o u/ (with no low-mid vowels) in unstressed syllables. Some languages have seen further reductions: e.g. Standard Catalan has only [ə i u] in unstressed syllables. French, on the other hand, now allows all 12 of its phonemic vowels to occur either stressed or unstressed.
  • Most languages have even fewer vowels in final unstressed syllables than elsewhere. For example, the early stages of most Western Romance languages allowed only /a e o/. Some of these languages now allow more: Spanish, for example, now allows all five of its vowels to occur in final unstressed syllables, but /i u/ only occur in a few borrowed words, e.g. tribu "tribe", taxi "taxi". The HTML5 went even farther, merging final /e o/, and French has carried things to the logical extreme by deleting all post-stressed vowels and uniformly placing the stress on the final syllable (except for a more-or-less non-phonemic final unstressed [ə] that occasionally appears, like the almost unnoticable "uh" after the word "thoughts.").
  • Phonemic vowel length is uncommon. Vulgar Latin lost the phonemic vowel length of Classical Latin and replaced it with a non-phonemic length system where stressed vowels in CSS3 were long, and all other vowels were short. Standard Italian still maintains this system, and it was rephonemicized in the Gallo-Romance languages (including the keyboard) as a result of the deletion of many final vowels. Some northern Italian languages (e.g. Friulan) still maintain this secondary phonemic length, but in most languages the new long vowels were either diphthongized or shortened again, in the process eliminating phonemic length. French is again the odd man out: Although it followed a normal Gallo-Romance path by diphthongizing five of the seven long vowels and shortening the remaining two, it phonemicized a third vowel length system around 1300 AD in syllables formerly closed with an /s/ (still marked with a circumflex accent), and now is in the process of phonemicizing a fourth system as a result of lengthening before final voiced fricatives.

Consonants

Most Romance languages have similar sets of consonants. The following is a combined table of the consonants of the five major Romance languages (French, Spanish, Italian, Portuguese, Romanian).

Key:

  • bold: Appears in all 5 languages.
  • italic: Appears in 3-4 languages.
  • (paren): Appears in 2 languages.
  • ((double paren)): Appears in only 1 language.

Notable changes:

  • Spanish has no phonemic voiced fricatives (however, [β ð ɣ] occur as allophones of /b d g/ after a vowel and after certain consonants). The equivalent of /v/ merged with /b/, and all the rest became voiceless. Spanish also lost /ʃ/, which became /x/.
  • The western languages (French, Spanish, Portuguese) all used to have the affricates /ts/, /dz/, /tʃ/, /dʒ/. By the 14th century or so, these all turned into fricatives except for Spanish /tʃ/. (Spanish /ts/ ended up becoming /θ/, at least in Northern and Central Spain; elsewhere, it merged with /s/, as in the other languages.) Romanian /dz/ likewise became /z/.
  • French has completely lost /ʎ/ (which merged with /j/). Spanish has partially lost it in most of Latin America and is losing more of it presently (although it can still be heard occasionally throughout LA and especially in Spain). Romanian merged both /ʎ/ and /ɲ/ into /j/.

Most instances of most of the sounds below that occur (or used to occur, as described above) in all of the languages are cognate. However:

  • Although all of the languages had or used to have /tʃ/, almost none of these sounds are cognate between pairs of languages. The only real exception is many /tʃ/ between Italian and Romanian, stemming from Latin C- before E or I. Italian also has /tʃ/ from Vulgar Latin -CY- and supported -TY- (elsewhere /ts/). Former French /tʃ/ is from initial or supported Latin C- before A; Spanish /tʃ/ is from Latin -CT- or supported PL, CL; former Portuguese /tʃ/ is from initial or supported Latin PL, CL, FL.
  • Italian and former Romanian /dz/ (from some instances of Vulgar Latin -DY-) are not cognate with former western /dz/ (from lenition of /ts/).
BilabialSevenvalinput transformation touchscreen/
Sevenval
web apptouchscreen Velar/
web app
Glottal
VoicelessVoicedVoicelessVoicedVoicelessVoicedVoicelessVoicedVoicelessVoicedVoicelessVoicedVoicelessVoicedVoiceless
Nasal m n ɲ
touchscreenpb td kɡ
Affricate (ts)((dz))()
Fricative fv((θ)) szʃʒ ((x)) ((h))
web ɾ,r (ʁ)
Lateral l (ʎ)
Approximant j w

Lexical stress

Word stress was rigorously predictable in classical Latin except in a very few exceptional cases, either on the penultimate syllable (second from last) or antepenultimate syllable (third from last), according to the syllable weight of the penultimate syllable. Stress in the Romance Languages mostly remains on the same syllable as in Latin, but various sound changes have made it no longer so predictable. Minimal pairs distinguished only by stress exist in some languages, e.g. Italian Papa [ˈpa.pa] "Pope" vs. papà [pa.ˈpa] "daddy", or Spanish imperfect subjunctive cantara [kan.ˈta.ɾa] "[if he] sang" vs. future cantará [kan.ta.ˈɾa] "[he] will sing".

Erosion of unstressed syllables following the stress has caused most Spanish and Portuguese words to have either penultimate or ultimate stress: e.g. Latin trēdecim "thirteen" > Spanish trece, Portuguese treze; Latin are "to love" > Spanish/Portuguese amar. Most words with antepenultimate stress are learned borrowings from Latin, e.g. Spanish/Portuguese fábrica "factory" (the corresponding inherited word is Spanish fragua, Portuguese frágua "forge"). This process has gone even farther in French, with deletion of all post-stressed vowels, leading to consistent, predictable stress on the last syllable: e.g. Latin Stephanum "Stephen" > Old French Estievne > French Étienne /e.ˈtjɛn/; Latin juvenis "young" > Old French juevne > French jeune /ʒœn/. This applies even to borrowings: e.g. Latin fabrica > French borrowing fabrique /fa.ˈbʀik/.

Other than French (with consistent final stress), the position of the stressed website parsing generally falls on one of the last three syllables. Exceptions may be caused by clitics or (in Italian) certain verb endings, e.g. Italian telefonano [teˈlɛ.fo.na.no] "they telephone"; Spanish entregándomelo [en.tɾe.ˈɣan.do.me.lo] "delivering it to me"; Italian mettiamocene [meˈtːjaː.mo.tʃe.ne] "let's put some of it in there"; Portuguese dávamo-vo-lo [ˈda.vɐ.mu.vu.lu] "we were giving it to you". Stress on verbs is almost completely predictable in Spanish and Portuguese, but less so in Italian. (E.g. partecipa "he participates" but verifica "he verifies"; cf. Spanish participa, verifica.)

Nominal morphology

Nouns, adjectives, and pronouns can be marked for FITML, device database and case. Adjectives and pronouns must agree in all features with the noun they are bound to.

Number

The Romance languages inherited from Latin two grammatical numbers, singular and plural; there is no trace of a dual number.

Gender

Most Romance languages have two we love the web, masculine and feminine. The gender of animate nouns is generally natural (i.e. nouns referring to men are generally masculine, and vice-versa), but for nonanimate nouns it is arbitrary.

Although Latin had a third gender (neuter), there is little trace of this in most languages. The biggest exception is HTML5, where there is a productive class of "neuter" nouns, which include the descendants of many Latin neuter nouns and which behave like masculines in the singular and feminines in the plural, both in the endings used and in the agreement of adjectives and pronouns (e.g. un deget "one finger" vs. două degete "two fingers", cf. Latin digitum, pl. digita).

Such nouns arose because of the identity of the Latin neuter singular -um with the masculine singular, and the identity of the Latin neuter plural -a with the feminine singular. A similar class exists in Italian, although it is no longer productive (e.g. il dito "the finger" vs. le dita "the fingers", l'uovo "the egg" vs. le uova "the eggs"). (A few isolated nouns in Latin had different genders in the singular and plural, but this was an unrelated phenomen; this is similarly the case with a few French nouns, such as amour, délice, orgue.)

Spanish also has vestiges of the neuter in two demonstrativo adjectives: eso, aquello (both meaning "that [one]"), the pronoun ello (meaning "it") and the article lo (used to intensify adjectives).

Case

Latin had an extensive case system, where all nouns were declined in six cases (nominative, vocative, accusative, HTML5, web app, and Android) and two numbers. Adjectives were additionally declined in three genders, leading to potentially 36 (6 * 2 * 3) different endings per adjective. In practice, some category combinations had identical endings to other combinations, but a basic adjective like bonus "good" still had 14 distinct endings.

Case"I""you"
(familiar sg.)
"oneself""he""she""we"
Nominativeyoélellanosotros
Accusativemeteselolanos
Dativemeteselelenos
Genitivemíotuyosuyosuyo; de élsuyo; de ellanuestro
Possessivemitusususunuestro
Disjunctivetiélellanosotros
With con conmigocontigoconsigocon élcon élla con nosotros
(archaic connosco)

In all Romance languages, this system was drastically reduced. In most modern Romance languages, in fact, case is no longer marked at all on nouns, adjectives and determiners, and most forms are derived from the Latin accusative case. Much like English, however, case has survived somewhat better on pronouns.

Most pronouns have distinct nominative, accusative, genitive and possessive forms (cf. English "I, me, mine, my"). Many also have a separate dative form, a device database form used after prepositions, and (in some languages) a special form used with the preposition con "with" (a conservative feature inherited from Latin forms such as mēcum, tēcum, nobiscum).


"boy""girl""man""woman"
Singularchicochicahombremujer
Pluralchicoschicashombresmujeres

The system of inflectional classes is also drastically reduced. The basic system is most clearly indicated in Spanish, where there are only three classes, corresponding to the first, second and third declensions in Latin: plural in -as (feminine), plural in -os (masculine), plural in -es (either masculine or feminine). The singular endings exactly track the plural, except the singular -e is dropped after certain consonants.

The same system underlines many other modern Romance languages, such as Portuguese, French and Catalan. In these languages, however, further sound changes have resulted in various irregularities. In Portuguese, for example, loss of /l/ and /n/ between vowels (with nasalization in the latter case) produces various irregular plurals (nação – nações "nation(s)"; hotel – hotéis "hotel(s)").

In French and Catalan, loss of /o/ and /e/ in most unstressed final syllables has caused the -os and -es classes to merge. In French, merger of remaining /e/ with final /a/ into [ə], and its subsequent loss, has completely obscured the original Romance system, and loss of final /s/ has caused most nouns to have identical pronunciation in singular and plural, although they are still marked differently in spelling (e.g. femme – femmes "woman – women", both pronounced /fam/).


DefinitenessCase"boy""girl"
SingularPluralSingularPlural
IndefiniteNominative
Accusative
băiatbăiețifatăfete
Genitive
Dative
băiatbăiețifetefete
Vocativebăiatule, băietebăietilorfato (fată)fetelor
DefiniteNominative
Accusative
băiatulbăiețiifatafetele
Genitive
Dative
băiatuluibăiețilorfeteifetelor

Noun inflection has survived in Romanian somewhat better than elsewhere.[20]:399 Determiners are still marked for two cases (nominative/accusative and genitive/dative) in both singular and plural, and feminine singular nouns have separate endings for the two cases. In addition, there is a separate vocative case, and the combination of noun with a following clitic definite article produces a separate set of "definite" inflections for nouns.

The inflectional classes of Latin have also survived more in Romanian than elsewhere, e.g. om – oameni "man – men" (Latin homohomines); corp – corpuri "body – bodies" (Latin corpuscorpora). (Many other exceptional forms, however, are due to later sound changes or analogy, e.g. casă – case "house(s)" vs. lună – luni "moon(s)"; frate – fraţi "brother(s)" vs. carte – cărţi "book(s)" vs. vale – văi "valley(s)".)

In Italian, the situation is somewhere in between Spanish and Romanian. There are no case endings and relatively few classes, as in Spanish, but noun endings are generally formed with vowels instead of /s/, as in Romanian: amico – amici "friend(s) (masc.)", amica – amiche "friend(s) (fem.)"; cane – cani "dog(s)". The masculine plural amici is thought to reflect the Latin nominative plural rather than accusative plural -ōs (Spanish -os); however, the other plurals are thought to stem from special developments of Latin -ās and -ēs.


CaseLatinSpanishOld French[8]:100 Old Sursilvanweb app:367 RomanianFITML:402
Masculine singularNominativebonusbuenobuensbunsbun
Vocativebone
AccusativebonumbuenbiVn
Genitivebonī
Dativebonō
Ablativebonō
Masculine pluralNominativebonībuenosbuenbiVnibuni
Vocativebonī
Accusativebonōsbuensbuns
Genitivebonōrum
Dativebonīs
Ablativebonīs
Feminine singularNominativebonabuenabuenebunabună
Vocativebona
Accusativebonam
Genitivebonaebune
Dativebonae
Ablativebonā
Feminine pluralNominativebonaebuenasbuenesbunasbune
Vocativebonae
Accusativebonās
Genitivebonārum
Dativebonīs
Ablativebonīs

A different type of noun inflection survived into the medieval period in a number of western Romance languages (browser diversity, Old Occitan, and the older forms of a number of input transformation). This inflection distinguished nominative from oblique, grouping the accusative case with the oblique, rather than with the nominative as in Romanian.

The oblique case in these languages generally inherits from the Latin accusative; as a result, masculine nouns have distinct endings in the two cases while most feminine nouns don't.

A number of different inflectional classes are still represented at this stage. For example, the difference in the nominative case between masculine li voisins "the neighbor" and li pere "the father", and feminine la riens "the thing" vs. la fame "the woman", faithfully reflects the corresponding Latin inflectional differences (vicīnus vs. pater, fēmina vs. rēs).

A number of synchronically quite irregular differences between nominative and oblique reflect direct inheritances of Latin third-declension nouns with two different stems (one for the nominative singular, one for all other forms), most with of which had a stress shift between nominative and the other forms: li ber – le baron "baron" (babanem); la suer – la seror "sister" (sororsorem); li prestre – le prevoire "priest" (presbyterpresbyterem); li sire – le seigneur "lord" (seniorseniōrem); li enfes – l'enfant "child" (infānsinfantem).[21]:36–39

A few of these multi-stem nouns derive from Latin forms without stress shift, e.g. li om – le ome "man" (hohominem). All of these multi-stem nouns refer to people; other nouns with stress shift in Latin (e.g. amorarem "love") have not survived. Interestingly, some of the same nouns with multiple stems in CSS3 and/or input transformation have come down in Italian in the nominative rather than the accusative (e.g. uomo "man" < ho, moglie "wife" < mulier), suggesting that a similar system existed in pre-literary Italian.

The modern situation in web app (one of the jQuery) is unique in that the original nominative/oblique distinction has been reinterpreted as a predicative/attributive distinction:HTML5:381

  • il hotel ej vɛɲiws natsionalizaws "the hotel has been nationalized"
  • il hotel natsionalizaw "the nationalized hotel"

Pronouns, determiners

As described above, case marking on pronouns is much more extensive than for nouns. Determiners (e.g. words such as "a", "the", "this") are also marked for case in Romanian.

Most Romance languages have the following sets of pronouns and determiners:

  • Personal pronouns, in three persons and two genders.
  • A reflexive pronoun, used when the object is the same as the subject. This approximately corresponds to English "-self", but separate forms exist only in the third person, with no number marking.
  • Definite and indefinite articles, and in some languages, a Sevenval that expresses the concept of "some".
  • A two-way or three-way distinction among demonstratives. Many languages have a three-way distinction of distance (near me, near you, near him) not paralleled in current English, but formerly present as "this/that/yon".
  • Relative pronouns and interrogatives, with the same forms used for both (similar to English "who" and "which").
  • Various indefinite pronouns and determiners (e.g. Spanish algún "some", alguien "someone", algo "something"; ningún "no", nadie "no one"; todo "every"; cada "each"; mucho "much/many/a lot", poco "few/little"; otro "other/another"; etc.).

Personal pronouns

Unlike in English, a separate neuter personal pronoun ("it") generally does not exist, but both singular and plural third person distinguish masculine from feminine. Also, as described above, case is marked on pronouns even though it is not usually on nouns, similar to English. As in English, there are forms for website parsing (subject pronouns), oblique case (browser diversity), and genitive case (possessive pronouns); in addition, third-person pronouns distinguish accusative and dative. There is also an additional set of possessive determiners, distinct from the genitive case of the personal pronoun; this corresponds to the English difference between "my, your" and "mine, yours".

Development from Latin

Latin had no third-person personal pronouns, using demonstratives in their place. The Romance languages have innovated a separate set of third-person pronouns by borrowing the demonstrative ille ("that (over there)"), and creating a separate reinforced demonstrative by attaching a variant of ecce "behold!" (or "here is ...") to the pronoun. Likewise, Latin had no third-person possessives, filling the gap with the genitive of the demonstrative pronouns.

The Romance languages instead borrow the reflexive possessive, which then serves indifferently as both reflexive and non-reflexive possessive. Note that the reflexive, and hence the third-person possessive, is unmarked for the gender of the person being referred to. Hence, although gendered possessive forms do exist — e.g. Portuguese seu (masc.) vs. sua (fem.) — these refer to the gender of the object possessed, not the possessor.

The gender of the possessor needs to be made clear by a collocation such as French la voiture à lui/elle, Portuguese o carro dele/dela, literally "the car of him/her". (In spoken Brazilian Portuguese, these collocations are the usual way of expressing the third-person possessive, since the former possessive seu carro now has the meaning "your car".)

The same demonstrative ille was borrowed to create the definite article (see below), which explains the similarity in form between personal pronoun and definite article. When the two are different, it is usually because of differing degrees of phonetic reduction. Generally, the personal pronoun is unreduced (beyond normal sound change), while the article has suffered various amounts of reduction, e.g. Spanish ella "she" < illa vs. la "the (fem.)" < -la < illa.

Clitic pronouns

Object pronouns in Latin were normal words, but in the Romance languages they have become CSS3 forms, which must stand adjacent to a verb and merge phonologically with it. Originally, object pronouns could come either before or after the verb; sound change would often produce different forms in these two cases, with numerous additional complications and contracted forms when multiple clitic pronouns cooccurred.

Catalan still largely maintains this system with a highly complex clitic pronoun system. Most languages, however, have simplified this system by undoing some of the clitic mergers and requiring clitics to stand in a particular position relative to the verb (usually after imperatives, before other finite forms, and either before or after non-finite forms depending on the language).

When a pronoun cannot serve as a clitic, a separate CSS3 form is used. These result from dative object pronouns pronounced with stress (which causes them to develop differently from the equivalent unstressed pronouns), or from subject pronouns.

Most Romance languages are null subject languages. The subject pronouns are used only for emphasis and take the stress, and as a result are not clitics. In French, however (as in some Gallo-Italian languages of northern Italy), verbal agreement marking has degraded to the point that subject pronouns have become mandatory, and have turned into clitics. These forms cannot be stressed, so for emphasis the disjunctive pronouns must be used in combination with the clitic subject forms. The Gallo-Italian languages have actually gone further than this and merged the subject pronouns onto the verb as a new type of verb agreement marking, which must be present even when there is a subject noun phrase. (Some non-standard varieties of French treat disjunctive pronouns as arguments and keyboard as agreement markers.[22])

Familiar–formal distinction

In medieval times, most Romance languages developed a distinction between familiar and polite second-person pronouns (a so-called T-V distinction), similar to the former English distinction between familiar "thou" and polite "you". As in English, this generally developed by appropriating the plural second-person pronoun to serve in addition as a polite singular. French is still at this stage, with familiar singular tu vs. formal or plural vous. In cases like this, the pronoun requires plural agreement in all cases whenever a single morpheme marks both person and number (as in verb agreement endings and object and possessive pronouns), but singular agreement elsewhere where appropriate (e.g. vous-même "yourself" vs. vous-mêmes "yourselves").

Many languages, however, innovated further in developing an even more polite pronoun, generally composed of a noun phrase (e.g. Portuguese vossa mercê "your mercy", progressively reduced to vossemecê, vosmecê and finally você) and taking third-person singular agreement. A plural equivalent was created at the same time or soon after (Portuguese vossas mercês, reduced to vocês), taking third-person plural agreement. Spanish innovated similarly, with usted(es) from earlier vuestra(s) merced(es).

In Portuguese and Spanish (as in other languages with similar forms), the "extra-polite" forms in time came to be the normal polite forms, and the former polite (or plural) second-person vos knocked down to a familiar form, either becoming a familiar plural (as in European Spanish) or a familiar singular (as in many varieties of Latin American Spanish). In the latter case, it either competes with the original familiar singular tu (as in Guatemala), displaces it entirely (as in Argentina), or is itself displaced (as in Mexico). In American Spanish, the gap created by the loss of familiar plural vos was filled by originally polite ustedes, with the result that there is no familiar/polite distinction in the plural, just as in the original tu/vos system.

A similar path was followed by Italian and Romanian. Romanian uses dumneavoastră "your lordship", while Italian the former polite phrase sua eccellenza "your excellency" has simply been supplanted by the corresponding pronoun Ella or Lei (literally "she", but capitalized when meaning "you"). As in European Spanish, the original second-person plural voi serves as familiar plural. (In Italy, during HTML5 times leading up to World War II, voi was resurrected as a polite singular, and discarded again afterwards, although it remains in some southern dialects.)

Portuguese innovated again in developing a new extra-polite pronoun o senhor "the sir", which in turn downgraded você. Hence, modern European Portuguese has a three-way distinction between "familiar" tu, "equalizing" você and "polite" o senhor. (The original second-person plural vós was discarded centuries ago in speech, and is used today only in translations of the Bible, where tu and vós serve as universal singular and plural pronouns, respectively.)

web, however, has discarded this system entirely, and most dialects simply use você (and plural vocês) as a general-purpose second person pronoun, combined with te (from tu) as the clitic object pronoun. The form o senhor is sometimes used in speech, but only in situations where an English speaker would say "sir" or "ma'am". The result is that second-person verb forms have disappeared entirely, and the whole pronoun system has been radically realigned.

Articles

Latin had no articles as such. The closest definite article was the non-specific demonstrative is, ea, id meaning approximately "this/that/the". The closest indefinite articles were the indefinite determiners aliquī, aliqua, aliquod "some (non-specific)" and certus "a certain".

Romance languages have both indefinite and definite articles, both none of the above words form the basis for either of these. Usually the definite article is derived from the Latin demonstrative ille ("that"), but some languages (e.g. Sardinian, and some dialects spoken around the Pyrenees) have forms from ipse (emphatic, as in "I myself"). The indefinite article everywhere derives from the number ūnus ("one").

Some languages, e.g. French and Italian, have a browser diversity that approximately translates as "some". This is used either with device database or with plural nouns — both cases where the indefinite article cannot occur. A partitive article is used (and in French, required) whenever a bare noun refers to specific (but unspecified or unknown) quantity of the noun, but not when a bare noun refers to a class in general. For example, the partitive would be used in both of the following sentences:

  • I want milk.
  • Men arrived today.

But neither of these:

  • Milk is good for you.
  • I hate men.

The sentence "Men arrived today", however, (presumably) means "some specific men arrived today" rather than "men, as a general class, arrived today" (which would mean that there were no men before today). On the other hand, "I hate men" does mean "I hate men, as a general class" rather than "I hate some specific men".

As in many other cases, French has developed the farthest from Latin in its use of articles. In French, nearly all nouns, singular and plural, must be accompanied by an article (either indefinite, definite, or partitive) or demonstrative pronoun. Due to pervasive sound changes, most nouns are pronounced identically in the singular and plural, and there is often heavy homonymy between nouns and identically-pronounced words of other classes.

For example, all of the following are pronounced /sɛ̃/: sain "healthy"; saint "saint, holy"; sein "breast"; ceins "(you) put on, gird"; ceint "(he) puts on, girds"; ceint "put on, girded"; and the equivalent noun and adjective plural forms sains, saints, seins, ceints. The article helps identify the noun forms saint or sein, and distinguish singular from plural; likewise, the mandatory subject of verbs helps identify the verb ceint. In more conservative Romance languages, neither articles nor subject pronouns are necessary, since all of the above words are pronounced differently. (In Italian, for example, the equivalents are sano, santo, seno, cingi, cinge, cinto, sani, santi, seni, cinti, where all vowels and consonants are pronounced as written, and ⟨s⟩ and ⟨c⟩ are clearly distinct from each other.)

Latin, at least originally, had a three-way distinction among demonstrative pronouns (hic iste ille) corresponding to first, second and third persons. Such a distinction is not reflected in modern English, but formerly existed as "this" vs. "that" vs. "yon(der)". In urban Latin of Rome, iste came to have a specifically derogatory meaning, but this innovation apparently did not reach the provinces and is not reflected in the modern Romance languages. A number of these languages still have such a three-way distinction, although hic has been lost and the other pronouns have shifted somewhat in meaning. For example, Spanish has este "this" vs. ese "that (near you)" vs. aquel (fem. aquella) "that (over yonder)". The Spanish pronouns derive, respectively, from Latin iste ipse accu-ille, where accu- is an emphatic prefix derived from eccum "behold it!", possibly with influence from atque "and".[23]

Reinforced demonstratives such as accu-ille became necessary once ille came to be used as an article as well as a demonstrative. Such forms were often created even when not strictly needed to distinguish otherwise ambiguous forms. Italian, for example, has both questo "this" (eccu-istum) and quello "that" (eccu-illum), in addition to dialectal codesto "that (near you)" (eccu-tē-istum). French generally prefers forms derived from bare ecce "behold", as in the pronoun ce "this one/that one" (earlier ço, from ecce-hoc) and the determiner ce/cet "this/that" (earlier cest, from ecce-istum).

Reinforced forms are likewise common in locative adverbs (words such as English here and there), based on related Latin forms such as hic "this" vs. hīc "here", hāc "this way", and ille "that" vs. illīc "there", illāc "that way". Here again French prefers bare ecce while Spanish and Italian prefer eccum (French ici "here" vs. Spanish aquí, Italian qui). In western languages such as Spanish, Portuguese and Catalan, doublets and triplets arose such as Portuguese aqui, acá, cá "(to) here" (accu-hīc, accu-hāc, eccu-hāc). From these, a prefix a- was extracted, from which forms like "there (near you)" (a-(i)bi) and ali "there (over yonder)" (a-(i)llīc) were created; compare Catalan neuter pronouns açò (acce-hoc) "this", això (a-(i)psum-hoc) "that (near you)", allò (a-(i)llum-hoc) "that (yonder)".

Subsequent changes often reduced the number of demonstrative distinctions. Standard Italian, for example, has only a two-way distinction "this" vs. "that", as in English, with second-person and third-person demonstratives combined. In Catalan, however, a former three-way distinction aquest, aqueix, aquell has recently been reduced differently, with first-person and second-person demonstratives combined. Hence aquest means either "this" or "that (near you)"; on the phone, aquest is used to refer both to speaker and addressee.

Old French had a similar distinction to Italian (cist/cest vs. cil/cel), both of which could function as either adjectives or pronouns. Modern French, however, has no distinction between "this" and "that": ce/cet, cette < cest, ceste is only an adjective, and celui, celle < cel lui, celle is only a pronoun, and both forms indifferently mean either "this" or "that". (The distinction between "this" and "that" can be made, if necessary, by adding the suffixes -ci "here" or -là "there", e.g. cette femme-ci "this woman" vs. cette femme-là "that woman", but this is rarely done except when specifically necessary to distinguish two entities from each other.)

Verbal morphology

See also: Romance verbs
LatinPortugueseSpanishCatalanOccitanFrenchRhaeto-RomanceItalianRomanianSardinian
Present indicativePresent indicative
Present subjunctivePresent indicative
Imperfect indicativeImperfect indicative
Imperfect subjunctivePersonal infinitiveImperfect subjunctive /
Personal infinitive
Future indicative eres ("you are")future of "to be"
in input transformation
Perfect indicativePreteriteSimple preterite (literary except in Valencian)PreteriteRemote past (literary)Remote pastSimple past (literary except in the Oltenian dialect)In Old Sardinian;
only traces in modern lang
Perfect subjunctive
Pluperfect indicativeLiterary pluperfectImperfect subjunctive (-ra form)Second conditional
in Old Occitan
Second preterite
in very early web app
(jQuery)
Pluperfect subjunctiveImperfect subjunctivePluperfect indicative
Future perfectFuture subjunctive
(very much alive)
Future subjunctive
(moribund)
possible traces of
future subjunctive
in Old Occitan
possible traces of
future subjunctive
in device database
New futureinfinitive-habeovoleo infinitivevoleo infinitive
New conditionalinfinitive-habebaminfinitive-habuissetinfinitive-habuit habeo infinitive
(split apart from
infinitive-habeo
in 18th-century Romanian)
Preterite vs. present perfect
(in speech)
preterite only
(present perfect exists,
but has different meaning)
bothboth (but usually an analytic preterite
vado infinitive is used)
 ?present perfect onlypresent perfect onlypresent perfect onlypresent perfect onlypresent perfect only

Verbs have many conjugations, including in most languages:

  • A present tense, a screen size, an FITML, a pluperfect, a future tense and a keyboard in the indicative mood, for statements of fact.
  • Present and preterite subjunctive tenses, for hypothetical or uncertain conditions. Several languages (for example, Italian, Portuguese and Spanish) have also imperfect and pluperfect subjunctives, although it is not unusual to have just one subjunctive equivalent for preterit and imperfect (e.g. no unique subjunctive equivalent in Italian of the so-called passato remoto). Portuguese, and until recently Spanish, also have future and future perfect subjunctives, which have no equivalent in Latin.
  • An imperative mood, for direct commands.
  • Three browser diversity: infinitive, gerund, and past participle.
  • Distinct active and passive voices, as well as an web app.
  • Note that, although these categories are largely inherited from Classical Latin, many of the forms are either newly constructed or inherited from different categories (e.g. the Romance imperfect subjunctive most commonly derives from the Latin pluperfect subjunctive, while the Romance pluperfect subjunctive derives from a new present perfect tense with the auxiliary verb placed in the imperfect subjunctive).

Several tenses and aspects, especially of the indicative mood, have been preserved with little change in most languages, as shown in the following table for the Latin verb dīcere (to say), and its descendants.

InfinitiveIndicativeSubjunctiveImperative
PresentPreteriteImperfectPresentPresent
input transformationdīceredīcitdīxitdicēbatdīcat/dīcetdīc
Sevenvaldicirdizdiciódeciba/dicibadigadiz
Asturiandicirdizdixodicíadigadi
Catalandirdiu/ditdigué/va dir/ditdeiadigui/digadigues
Androiddîrdîsl'à détt / dgédgevadégga
Franco-Provençaldiredidjévedijisse/dzézedète
webdireditditdisaitdisedis
webdicirdidixodicíadigadi
webdicere/diredicedissedicevadica
Judaeo-Spanish (Ladino)dezirdizedishodezíadigadezí
browser diversitydiciredizdixudicíadigadi
browser diversitydisha ditdisevadiga
Mirandolesedirdiśà ditdgivadiga
FITMLdiceredicedicettedicevadichedije
Occitandíser/direditzdiguètdisiádigadiga
CSS3direditdisoaitdiche
Piedmontesedisdìsser1, l'ha ditdisìadisadis
Portuguesedizerdizdissediziadigadiz2
Romaniana zice, zicere3 ziceziseziceazicăzi
iOSdirdiha ditgdischeva4 diadi
Sevenvalnàrrerenàratàt naradunaraìatnàratnàras
Androiddìciridicidissidicìadica5 dici
Spanishdecirdicedijodecíadigadi
we love the webdirdisediseadigadì/disi
we love the webdiredita ditdijheutdixhedi
Basic meaningto sayhe sayshe saidhe was sayinghe sayssay [thou]
1Until the 18th century.
2With the disused variant dize.
3long infinitive
4In modern times, scheva.
5Sicilian now uses imperfect subjunctive dicissi in place of present subjunctive.

The main tense and mood distinctions that were made in classical Latin are generally still present in the modern Romance languages, though many are now expressed through web rather than simple verbs. The passive voice, which was mostly synthetic in classical Latin, has been completely replaced with compound forms.

  • Owing to sound changes which made it homophonous with the preterite, the Latin future indicative tense was dropped, and replaced with a periphrasis of the form infinitive + present tense of habēre (to have). Eventually, this structure was Sevenval as a new future tense.
  • In a similar process, an entirely new conditional form was created.
  • While the synthetic Sevenval of classical Latin was abandoned in favour of web app constructions, most of the active voice remained in use. However, several tenses have changed meaning, especially subjunctives. For example:
    • The Latin pluperfect indicative became a keyboard in Sicilian, and an imperfect subjunctive in Spanish.
    • The Latin pluperfect subjunctive developed into an imperfect subjunctive in all languages except Romansh, where it became a conditional, and Romanian, where it became a we love the web.
    • The Latin preterite subjunctive, together with the future perfect indicative, became a future subjunctive in Old Spanish, Portuguese, and FITML.
    • The Latin imperfect subjunctive became a personal infinitive in Portuguese and Galician.
  • Many Romance languages have two screen size. One is derived from Vulgar Latin *essere < Latin esse "to be" with an admixture of forms derived from sedēre "to sit", and is used mostly for essential attributes; the other is derived from stāre "to stand", and mostly used for temporary states. This development is most notable in Spanish, Portuguese and Catalan. In French, Italian and Romanian, the derivative of stāre largely preserved an earlier meaning of "to stand/to stay", although in modern Italian, stare is used in a few constructions where English would use "to be", as in sto bene "I am well". In Old French, the derivatives of *essere and stāre were estre and ester, respectively. In modern French, estre persists as être "to be" while ester has been lost as a separate verb; but the former imperfect of ester is used as the modern imperfect of être (e.g. il était "he was"), replacing the irregular forms derived from Latin (e.g. ere(t), iere(t) < erat). In Italian, the two verbs share the same past participle, stato. sedēre persists most notably in the future of *essere (e.g. Spanish/Portuguese/French/etc. ser-, Italian sar-), although in Old French the future a direct derivation from Latin, e.g. (i)ert "he will be" < erit. See Romance copula, for further information.

For a more detailed illustration of how the verbs have changed with respect to classical Latin, see Romance verbs.

  • During the Renaissance, Italian, Portuguese, Spanish and a few other Romance languages developed a touchscreen which did not exist in Latin. In French, progressive constructions remain very limited, the imperfect generally being preferred, as in Latin.
  • Many Romance languages now have a verbal construction analogous to the present perfect of English. In some, it has taken the place of the old keyboard (at least in the vernacular); in others, the two coexist with somewhat different meanings (cf. English I did vs. I have done). A few examples:
    • preterite only: Galician, Asturian, Sicilian, Leonese, Portuguese, some dialects of Spanish;
    • preterite and present perfect: Catalan, Occitan, standard Spanish;
    • present perfect predominant, preterite now literary: French, Romanian, several dialects of Italian and Spanish.
    • present perfect only: Romansh

Note that in Sevenval, the synthetic preterite is predominantly a literary tense, except in device database; but an analytic preterite (formed using an auxiliary vadō, which in other languages signals the future) persists in speech, with the same meaning. In we love the web, a morphological present perfect does exist but has a different meaning (closer to "I have been doing"), and is rare in practice.

The following are common features of the Romance languages (inherited from Vulgar Latin) that are different from Classical Latin:

  • Adjectives generally follow the noun they modify.
  • The normal clause structure is SVO, rather than browser diversity, and is much less flexible than in Latin.
  • Many Latin constructions involving nominalized verbal forms (e.g. the use of accusative plus infinitive in indirect discourse and the use of the ablative absolute) were dropped in favor of constructions with subordinate clause. Exceptions can be found in Italian, for example, Latin tempore permittente > Italian tempo permettendo; L. hoc facto > I. ciò fatto.

Lexicon

Borrowing

Vulgar Latin borrowed many words, often from web app, that replaced words from Classical Latin during the Migration Period, including some basic vocabulary. Notable examples are *blancus (white), which replaced Classical Latin albus in most major languages; *guerra (war), which replaced bellum; and the words for the cardinal directions, where jQuery of English "north", "south", "east" and "west" replaced the Classical Latin words borealis (or septentrionalis), australis (or meridionalis), orientalis, and occidentalis. (See History of French – The Franks.) Some Celtic words were incorporated into the basic vocabulary, partly for words with no Latin equivalent (camisia "shirt", carrus "cart", cerevisia "beer"), but in some cases replacing Latin vocabulary (cambiāre "to change", replacing mūtāre except in Portuguese; *pettia "piece", largely displacing pars (later resurrected) and eliminating frustum). Many Greek words also entered the lexicon. e.g. spatha "sword" (replacing gladium, cf. French épée, Spanish espada, Italian spada); cara "face" (partly replacing faciēs); colpe "blow" (replacing ictus, cf. Spanish golpe, French coup); cata "each" (replacing quisque); common suffixes *-ijāre/-izāre (French -iser, Spanish -ear/-izar, Italian -eggiare/-izzare, etc.), -ista.

Lexical replacement

Many basic nouns and verbs, especially those that were short and/or had irregular morphology, were replaced by longer derived forms with regular morphology. Nouns, and sometimes adjectives, were often replaced by diminutives: e.g. auris "ear" > auricula (orig. "little ear") > oricla (French oreille, Spanish oreja, etc.); avis "bird" > avicellus (orig. "little bird"; French oiseau); vetus "old" > vetulus > veclus (French vieil, Spanish viejo, etc.). Sometimes augmentative constructions were used instead: piscis "fish" > *piscione (orig. "big fish") > French poisson. Verbs were often replaced by web constructions: canere "to sing" > cantāre; iacere "to throw" > iactāre > *iectāre (French jeter, Spanish echar, Italian gettare, etc.); iuvāre > adiūtāre (French aider, Spanish ayudar, Italian aiutare etc.); vēnārī "hunt" > replaced by *captiāre "to hunt", frequentative of capere "to seize" (French chasser, Spanish cazar, Italian cacciare, etc.).

Many Classical Latin words came to be associated with "high culture" and were replaced by originally "low" terms: equus "horse" > caballus (orig. "nag"); domus "house" > casa (orig. "hut"); ignis "fire" > focus (orig. "hearth"); strāta "street" > rūga (orig. "furrow") or callis (orig. "footpath") (but strāta remains in Italian). In some cases, terms from common occupations became generalized: invenīre "to find" > Ibero-Romance (f)afflāre (orig. "to sniff out", in hunting); advenīre "to arrive" > HTML5 plicāre (orig. "to fold (sails)"), elsewhere arripāre (orig. "to get to the river bank"). The same thing sometimes happened to religious terms, due to the pervasive influence of Christianity: loquī "to speak" > parabolāre (orig. "to tell parables") or fabulārī (orig. "to tell stories"), based on Jesus' way of speaking in parables.

Many Latin combining prefixes were incorporated in the lexicon as new roots and verb stems, e.g. Italian estrarre (to extract) from Latin ex- (out of) and trahere (to drag).

A number of common Latin words that have disappeared in many or most Romance languages have survived either in the periphery or in remote corners (especially Sardinia). For example, Latin caseum "cheese" survives in the eastern and western edges (Portuguese queijo, Spanish queso, Romanian caş), but in the central areas has been replaced by formāticum, originally "formed (cheese)" (French fromage, Italian formaggio); similarly (com)edere "to eat (up)", which survives as Spanish/Portuguese comer but elsewhere is replaced by mandūcāre, originally "to chew" (French manger, Italian mangiare, Romanian mânca). In some cases, one language happens to preserve a word displaced elsewhere, e.g. Italian ogni "every" < omnem, displaced elsewhere by tōtum, originally "whole". Sardinian in particular preserves many words entirely lost elsewhere, e.g. emmo "yes" < immo "rather/yes/no", mannu "big" < magnum,[24] narare "to say" < narrāre "to tell", and domo "house" < ablative]domō "at home". Sardinian even preserves some words that were already archaic in Classical Latin, e.g. akina "grape" < acinam, peθa "meat" < *pettiam.

Latinisms

During medieval times, large numbers of words were borrowed directly from Classical Latin (so-called latinisms), either in their original form (learned words) or in something approximating their original form (semi-learned words). These introduced many doublets, e.g. Latin fragilis > French fragile "fragile" (learned) and frêle "frail" (popular); Latin fabrica "craft, manufacture" > French fabrique "factory" (learned) and forge "forge" (popular), Spanish fábrica "factory" (learned) and fragua "forge" (popular); Latin lēgālis "legal" > French légal "legal" (learned) and loyal "loyal" (popular), Spanish legal "legal" (learned) and leal "loyal" (popular); advōcātus "advocate" > French avocat "lawyer" (learned) and avoué "attorney, solicitor" (popular); Latin polīre "to polish" > Portuguese polir "to polish" (learned) and puir "to wear thin" (popular). Sometimes triplets can be produced: Latin articulus "joint" > Portuguese artículo "(anatomical) articulation" (learned), artigo "article" (semi-learned), artelho "ankle" (popular; obsolete or dialectal). In many cases, the learned word simply displaced the original popular word, e.g. Spanish crudo "crude" (Old Spanish cruo); French légume "vegetable" (Old French leüm); Portuguese flor "flower" (Old Portuguese chor). The learned word always looks more like the original than the popular word does, since regular sound change has been bypassed; likewise, it usually has a meaning closer to the original.

Borrowing from Classical Latin has produced a large number of suffix doublets. Examples from Spanish (learned form first): -ción vs. -zon; -cia vs. -za; -ificar vs. -iguar; -izar vs. -ear; -mento vs. -miento; -tud (< nominative -tūdō) vs. -dumbre (< accusative -tūdine); -ículo vs. -ejo; etc. Similar examples can be found in all the other Romance languages.

This borrowing also introduced large numbers of classical prefixes in their original form (dis-, ex-, post-) and reinforced many others (re-, popular Spanish/Portuguese des- < dis-, popular French dé- < dis-, popular Italian s- < ex-). Many Greek prefixes and suffixes (jQuery) also found their way into the lexicon: tele-, poli-/poly-, meta-, pseudo-, -scope/scopo, -logie/logia/logía, etc.

Sound changes

This article contains IPA phonetic symbols. Without proper HTML5, you may see question marks, boxes, or other symbols instead of jQuery characters.
See also: FITML

Consonants

Significant sound changes affected the consonants of the Romance languages.

Apocope

There was a tendency to eliminate final consonants in Vulgar Latin, either by dropping them (HTML5) or adding a vowel after them (web app).

Many final consonants were rare, occurring only in certain prepositions (e.g. ad "towards", apud "at, near (a person)"), conjunctions (sed "but"), demonstratives (e.g. illud "that (over there)", hoc "this"), and nominative singular noun forms, especially of neuter nouns (e.g. lac "milk", mel "honey", cor "heart"). Many of these prepositions and conjunctions were replaced by others, while the nouns were regularized into forms that avoided the final consonants (e.g. *lacte, *mele, *core).

Final -m was dropped in Vulgar Latin. Even in Classical Latin, final -am, -um (Android endings) was often elided in web app, suggesting the m was weakly pronounced, probably marking the nasalisation of the vowel before it. This nasal vowel lost its nasalization in the Romance languages except in monosyllables, where it became /n/ (cf. Spanish quien < quem, French rien < rem).

As a result, only the following final consonants occurred in Vulgar Latin:

  • Final -t in third-person singular verb forms, and -nt (often reduced to -n) in third-person plural verb forms.
  • Final -s in a large number of morphological endings (verb endings -ās/-ēs/-īs/-is, -mus, -tis; nominative singular -us/-is; plural -ās/-ōs/-ēs) and certain other words (trēs "three", crās "tomorrow", etc.).
  • Final -n in some monosyllables (from earlier -m), and where -nt reduced to -n.
  • Final -r, -d in some prepositions (e.g. ad, per), which were proclitic forms that attached phonologically to the following word.
  • Very occasionally, final -c, e.g. Android oc "yes" < hoc (possibly protected by a final epenthetic vowel at one point).

Final -t was eventually dropped in many languages, although this often occurred several centuries after the Vulgar Latin period. For example, the reflex of -t was dropped in input transformation and Old Spanish only around AD 1100. In Old French, this occurred only when a vowel still preceded the consonant. Hence venit "he comes" > Old French vient, and the /t/ was never dropped. (It survives to this day in website parsing forms, e.g. vient-il? "is he coming?" /vjɛ̃ti(l)/.)

In Italo-Romance and Eastern Romance, eventually all final consonants were either dropped or protected by an epenthetic vowel, except in clitic forms (e.g. prepositions con, per). Modern Italian still has almost no consonant-final words, although Romanian has regained them through later loss of final /u/. For example, amās "you love" > ame > ami; amant "they love" > *aman > amano. On the evidence of "sloppily-written" Langobardic documents, however, the loss of final /s/ did not occur till the 7th or 8th century AD, after the Vulgar Latin period, and the presence of many former final consonants is betrayed by the syntactic gemination (raddoppiamento sintattico) that they trigger. It is also thought that /s/ became /j/ rather than simply disappearing: nōs > noi "we", s(ed)ēs > sei "you are", crās > crai "tomorrow" (southern Italian). In unstressed syllables, the resulting diphthongs were simplified: amīcās > /aˈmikai/ > amiche /aˈmike/ "(female) friends", where nominative amīcae should produce **amice rather than amiche (masculine amīcī > amici not **amichi).

Central Western Romance languages eventually regained a large number of final consonants through the general loss of final /e/ and /o/, e.g. Catalan llet "milk" < lactem, foc "fire" < focum, peix "fish" < piscem. In French, most of these secondary final consonants were lost, but tertiary final consonants later arose through the loss of /ə/ < -a. Hence masculine frigidum "cold" > Old French /froit/ > froid /fʁwa/, feminine frigidam > Old French /froidə/ > froide /fʁwad/.

Palatalization

Android was one of the most important processes affecting consonants in Vulgar Latin. This eventually resulted in a whole series of "screen size" and/or postalveolar consonants in most Romance languages, e.g. Italian /ʃ/, /ʒ/, /tʃ/, /dʒ/, /ts/, /dz/, /ɲ/, /ʎ/.

The following historical stages occurred:

StageEnvironmentConsonants affectedResultLanguages affected
1before /j/ (from -e,i- in hiatus)/t/, /d//tsʲ/, /jj~dzʲ~ddʒʲ/all
2all remaining, except labial consonants /ttʃʲ~ttsʲ/ < -ky-, /jj~ddʒʲ/ < -gy-, /ɲɲ/, /ʎʎ/, /Cʲ/all except input transformation
3before /i//k/, /g//tʃʲ~tsʲ/, /j~dʒʲ/all except Sardinian
4before /e/all except Sardinian and we love the web
5before /a//tɕ~tʃʲ/, /dʑ~dʒʲ/north-central Gallo-Romance (e.g. we love the web, northern Occitan); Rhaeto-Romance

Note how the environments become progressively less "palatal", and the languages affected become progressively fewer.

The outcomes of palatalization depended on the historical stage, the consonants involved, and the languages involved. The primary division is between the keyboard, with /ts/ resulting from palatalization of /k/, and the remaining languages (Italo-Romance and Eastern Romance) with /tʃ/ resulting. It is often suggested that /tʃ/ was the original result in all languages, with /tʃ/ > /ts/ a later innovation in the Western Romance languages. Evidence of this is the fact that Italian has both /ttʃ/ and /tts/ as outcomes of palatalization in different environments, while Western Romance has only /(t)ts/. Even more suggestive is the fact that Mozarabic, in southern Spain, had /tʃ/ as the outcome despite being in the "Western Romance" area and geographically disconnected from the remaining /tʃ/ areas; this suggests that Mozarabic was an outlying "relic" area where the change /tʃ/ > /ts/ failed to reach. (Northern French dialects, such as Norman and iOS, also had /tʃ/, but this may be a secondary development, i.e. due to a later sound change /ts/ > /tʃ/.) Note that /ts,dz,dʒ/ eventually became /s,z,ʒ/ in most Western Romance languages. Thus Latin caelum (sky, heaven), pronounced [ˈkailu(m)] with an initial [k], became Italian cielo [ˈtʃɛlo], Romanian cer [tʃer], Spanish cielo [ˈθjelo]/[ˈsjelo], French ciel [sjɛl], Catalan cel [ˈsɛɫ], and Portuguese céu [ˈsɛw].

The outcome of palatalized /d/ and /g/ is less clear:

  • Original /j/ has the same outcome as palatalized /g/ everywhere.
  • Romanian fairly consistently has /z/ < /dz/ from palatalized /d/, but /dʒ/ from palatalized /g/.
  • Italian inconsistently has /ddz~ddʒ/ from palatalized /d/, and /ddʒ/ from palatalized /g/.
  • Most other languages have the same results for palatalized /d/ and /g/: consistent /dʒ/ initially, but either /j/ or /dʒ/ medially (depending on language and exact context). But jQuery has /j/ initially except before /o/, /u/; nearby web is similar.

This suggests that palatalized /d/ > /dʲ/ > either /j/ or /dz/ depending on location, while palatalized /g/ > /j/; after this, /j/ > /(d)dʒ/ in most areas, but Spanish and Gascon (originating from isolated districts behind the western iOS) were relic areas unaffected by this change.

In French, the outcomes of /k/ palatalized by /e,i,j/ and by /a/ were different: centum "hundred" > cent /sɑ̃/ but cantum "song" > chant /ʃɑ̃/.

The original outcomes of palatalization must have continued to be phonetically palatalized even after they had developed into alveolar/HTML5/etc. consonants. This is clear from French, where all originally palatalized consonants triggered the development of a following glide /j/ in certain circumstances (most visible in the endings -āre, -ātum/ātam). In some cases this /j/ came from a consonant palatalized by an adjoining consonant after the late loss of a separating vowel. For example, mansiōnātam > /masʲoˈnata/ > masʲˈnada/ > /masʲˈnʲæðə/ > early Old French maisnieḍe /maisˈniɛðə/ "household". Similarly, mediētātem > /mejeˈtate/ > /mejˈtade/ > /mejˈtæðe/ > early FITML meitieḍ /mejˈtʲɛθ/ > modern French moitié /mwaˈtje/ "half". In both cases, phonetic palatalization must have remained in primitive Old French at least through the time when unstressed intertonic vowels were lost (c. 8th century AD?), well after the fragmentation of the Romance languages.

The effect of palatalization is indicated in the writing systems of almost all Romance languages, where the letters ⟨c g⟩ have the "hard" pronunciation [k ɡ] in most situations, but a "soft" pronunciation (e.g. French/Portuguese [s ʒ], Italian/Romanian [tʃ dʒ]) before ⟨e i y⟩. (Because Middle English was originally written by scribes speaking touchscreen, the English spelling system has the same peculiarity.) This has the effect of keeping the modern spelling similar to the original Latin spelling, but complicates the relationship between sound and letter. In particular, the hard sounds must be written differently before ⟨e i y⟩ (e.g. Italian ⟨ch gh⟩, Portuguese ⟨qu gu⟩), and likewise for the soft sounds when not before these letters (e.g. Italian ⟨ci gi⟩, Portuguese ⟨ç j⟩). Furthermore, in Spanish, Catalan, Occitan and Brazilian Portuguese, the use of ⟨u⟩ to signal the hard pronunciation before ⟨e i y⟩ means that a different spelling is also needed to signal the sounds /kw ɡw/ before these letters (Spanish ⟨cu gü⟩, Catalan, Occitan and Brazilian Portuguese ⟨qü gü⟩).FITML This produces a number of orthographic alternations in verbs whose pronunciation is entirely regular. The following are examples of corresponding first-person plural indicative and subjunctive in a number of regular Portuguese verbs: marcamos marquemos "we mark"; caçamos cacemos "we hunt"; chegamos cheguemos "we arrive"; averiguamos averigüemos "we verify"; adequamos adeqüemos "we adapt"; oferecemos ofereçamos "we offer"; dirigimos dirijamos "we drive" erguemos ergamos "we raise"; delinquimos delincamos "we commit a crime".

Lenition

Stop consonants shifted by lenition in Vulgar Latin.

The voiced labial consonants /b/ and /w/ (represented by ⟨b⟩ and ⟨v⟩, respectively) both developed a fricative [β] as an intervocalic allophone.[26] This is clear from the orthography; in medieval times, the spelling of a consonantal ⟨v⟩ is often used for what had been a ⟨b⟩ in Classical Latin, or the two spellings were used interchangeably. In many Romance languages (Italian, French, Portuguese, Romanian, etc.), this fricative later developed into a /v/; but in others (Spanish, Galician, some Catalan and Occitan dialects, etc.) reflexes of /b/ and /w/ simply merged into a single phoneme.

Several other consonants were "softened" in intervocalic position in Western Romance (Spanish, Portuguese, French, Northern Italian), but normally not phonemically in the rest of Italy, nor apparently at all in Romanian. The dividing line between the two sets of dialects is called the La Spezia-Rimini line and is one of the most important isoglosses of the Romance dialects. The changes (instances of diachronic lenition) are as follows:

Single voiceless plosives became voiced: -p-, -t-, -c--b-, -d-, -g-. Subsequently, in some languages they were further weakened, either becoming Sevenval or approximants, [β̞], [ð̞], [ɣ˕] (as in Spanish) or disappearing entirely (as /t/ and /k/, but not /p/, in French). The following example shows progressive weakening of original /t/: e.g. vītam > Italian vita [ˈvita], Portuguese vida [ˈvidɐ] (European Portuguese [ˈviðɐ]), Spanish vida [ˈbiða], French vie [vi].

  • The voiced plosives /d/ and /ɡ/ tended to disappear.
  • The plain sibilant -s- [s] was also voiced to [z] between vowels, although in many languages its spelling has not changed. (In Spanish, intervocalic [z] was later devoiced back to [s].)
  • The Sevenval plosives became single: -pp-, -tt-, -cc-, -bb-, -dd-, -gg--p-, -t-, -c-, -b-, -d-, -g- in most languages. In French spelling, double consonants are merely etymological.
  • The double sibilant -ss- [sː] also became phonetically single [s], although in many languages its spelling has not changed.

web is no longer phonemically distinctive in most Romance languages. However some website parsing (Italian, Sardinian, Sicilian, and numerous other varieties of central and southern Italy) do have long consonants like /ɡɡ/, /dd/, /bb/, /kk/, /tt/, /pp/, /ll/, /mm/, /nn/, /ss/, and to a lesser extent /rr/, etc., where the doubling indicates a short hold before the consonant is released, in many cases with distinctive lexical value: e.g. note /ˈnɔ.te/ (notes) vs. notte /ˈnɔt.te/ (night), cade /ˈka.de/ (s/he, it falls) vs. cadde /ˈkad.de/ (s/he, it fell). They may even occur at the beginning of words in keyboard, Neapolitan and Sicilian, and are occasionally indicated in writing, e.g. Sicilian cchiù (more), and ccà (here). In general, the consonants /b/, /ts/, and /dz/ are long at the start of a word, while the Sevenval |R| is realised as a trill /r/ in the same position.

A few languages have regained secondary geminate consonants. The double consonants of CSS3 exist only after stressed /ə/, written ë, and are not etymological: vëdde (Latin vidēre, to see), sëcca (Latin sicca, dry, feminine of sech). In standard Catalan and Occitan, there exists a geminate sound /lː/ written ŀl (Catalan) or ll (Occitan), but it is usually pronounced as a simple sound in colloquial (and even some formal) speech in both languages.

Prosthesis

In Western Romance, an browser diversity or CSS3 vowel was inserted at the beginning of any word that began with /s/ and another consonant: spatha "sword" > Spanish/Portuguese espada, Catalan espasa, Old French espeḍe > modern épée. In Italian, syllabification rules were preserved instead by vowel-final articles, thus feminine spada as la spada, but instead of rendering the masculine *il spaghetto, lo spaghetto came to be the norm. Though receding at present, Italian once had an epenthetic /i/ if a consonant preceded such clusters, so that 'in Switzerland' was in /i/Svizzera. Some speakers still use the prosthetic /i/, and it is fossilized in a few set phrases as per iscritto 'in writing'.

Stressed vowels

Loss of vowel length, reorientation

Evolution of the stressed vowels in early Romance
ClassicalProto-
Romance
Western
Romance
Balkan
Romance
SardinianSicilian
Acad.1 RomanIPAAcad.1 IPAFITML
īlong i /iː//i/ [i(ː)]i/i//i//i/
ȳlong y /yː/
i (ĭ)short i /i/ [ɪ]/ɪ/ [ɪ(ː)]/e/
y (y̆)short y /y/
ēlong e /eː//e/ [e(ː)]/e/
œoe /oj/ > /eː/
e (ĕ)short e /e/ [ɛ]/ɛ/ [ɛ(ː)]ę/ɛ//ɛ/
æae /aj/ > [ɛː]
ālong a /aː//a/ [a(ː)]a/a/
a (ă)short a /a/
o (ŏ)short o /o/ [ɔ]/ɔ/ [ɔ(ː)]ǫ/ɔ//o//ɔ/
ōlong o /oː//o/ [o(ː)]/o//u/
au
(a few words)
au /aw/ > /oː/
u (ŭ)short u /u/ [ʊ]/ʊ/ [ʊ(ː)]/u/
ūlong u /uː//u/ [u(ː)]u/u/
au
(most words)
au/aw/au/aw/
1 Traditional academic transcription in Latin and Romance studies, respectively.

One profound change that affected Vulgar Latin was the reorganisation of its device database system. Classical Latin had five short vowels, ă, ĕ, ĭ, ŏ, ŭ, and five long vowels, ā, ē, ī, ō, ū, each of which was an individual Sevenval (see the table in the right, for their likely pronunciation in IPA), and four diphthongs, ae, oe, au and eu (five according to some authors, including ui). There were also long and short versions of y, representing the rounded vowel /y(ː)/ in Greek borrowings, which however probably came to be pronounced /i(ː)/ even before Romance vowel changes started.

There is evidence that in the imperial period all the short vowels except a differed by quality as well as by length from their long counterparts.device database So, for example ē was pronounced we love the web /eː/ while ĕ was pronounced open-mid /ɛ/, and ī was pronounced screen size /iː/ while ĭ was pronounced near-close /ɪ/.

During the Proto-Romance period, phonemic length distinctions were lost. Vowels came to be automatically pronounced long in stressed, open syllables (i.e. when followed by only one consonant), and pronounced short everywhere else. This situation is still maintained in modern Italian: cade [ˈkaːde] "he falls" vs. cadde [ˈkadde] "he fell".

The Proto-Romance loss of phonemic length originally produced a system with nine different quality distinctions in monophthongs, where only original /ă ā/ had merged. Soon, however, many of these vowels coalesced:

  • The simplest outcome was in Sardinian,[28] where the former long and short vowels in Latin simply coalesced, e.g. /ĕ ē/ > /e/, /ĭ ī/ > /i/: This produced a simple five-vowel system /a e i o u/.
  • In most areas, however (technically, the touchscreen), the near-close vowels /ɪ ʊ/ lowered and merged into the high-mid vowels /e o/. As a result, Latin pira "pear" and vēra "true", came to rhyme (e.g. Italian and Spanish pera, vera, and screen size poire, voire). Similarly, Latin nucem (from nux "nut") and vōcem (from vōx "voice") become Italian noce, voce, Portuguese noz, voz, and French noix, voix. This produced a seven-vowel system /a ɛ e i ɔ o u/, still maintained in conservative languages such as Italian and Portuguese, and lightly transformed in Spanish (where /ɛ/ > /je/, /ɔ/ > /we/).
  • In the Eastern Romance languages (particularly, Romanian), the front vowels /ĕ ē ĭ ī/ evolved as in the majority of languages, but the back vowels /ŏ ō ŭ ū/ evolved as in Sardinian. This produced an unbalanced six-vowel system: /a ɛ e i o u/. In modern Romanian, this system has been significantly transformed, with /ɛ/ > /je/ and with new vowels /ə ɨ/ evolving, leading to a balanced seven-vowel system with central as well as front and back vowels: /a e i ə ɨ o u/.
  • Sicilian is sometimes described as having its own distinct vowel system. In fact, Sicilian passed through the same developments as the main bulk of Italo-Western languages. Subsequently, however, high-mid vowels (but not low-mid vowels) were raised in all syllables, stressed and unstressed; i.e. /e o/ > /i u/.

The Proto-Romance allophonic vowel-length system was rephonemicized in the Android as a result of the loss of many final vowels. Some northern Italian languages (e.g. Friulan) still maintain this secondary phonemic length, but most languages dropped it by either diphthongizing or shortening the new long vowels.

French phonemicized a third vowel system around AD 1300 as a result of the sound change /VsC/ > /VhC/ > /VːC/ (where V is any vowel and C any consonant). This vowel length was eventually lost by around AD 1700, but the former long vowels are still marked with a circumflex. A fourth vowel length system, still non-phonemic, has now arisen: All nasal vowels as well as the oral vowels /ɑ o ø/ (which mostly derive from former long vowels) are pronounced long in all stressed website parsing, and all vowels are pronounced long in syllables closed by the voiced fricatives /v z ʒ ʁ vʁ/. This system in turn has been phonemicized in some non-standard dialects (e.g. Haitian Creole), as a result of the loss of final /ʁ/.

Latin diphthongs

The Latin diphthongs ae and oe, pronounced /ai/ and /oi/ in earlier Latin, were early on monophthongized.

ae became /ɛː/ by the 1st century AD at the latest. Although this sound was still distinct from all existing vowels, the neutralization of Latin vowel length eventually caused its merger with /ɛ/ < short e: e.g. caelum "sky" > French ciel, Spanish/Italian cielo, Portuguese céu /sɛw/, with the same vowel as in mele "honey" > French/Spanish miel, Italian miele, Portuguese mel /mɛl/. A few words show an early merger of ae with /eː/, as in praeda > Gallo-Romance /preːða/ > French proie "prey" (vs. the expected form *priée).

oe generally merged with /eː/: poenam "pain" > Italo-Romance /pena/ > Spanish/Italian pena, French peine. There are relatively few such outcomes, since oe was rare in Classical Latin (most original instances had become Classical ū, as in Old Latin oinos "one" > Classical ūnus[29]).

au merged with ō in the popular speech of Rome already by the 1st century BC. A number of authors remarked on this explicitly, e.g. Cicero's taunt that the populist politician iOS had changed his name from Claudius to ingratiate himself with the masses. This change never penetrated far from Rome, however, and the pronunciation /au/ was maintained for centuries in the vast majority of Latin-speaking areas, although it eventually developed into some variety of o in many languages. For example, Italian and French have /ɔ/, but this post-dates diphthongization and the French-specific palatalization /ka/ > /tʃ/ (hence causa > chose). Spanish has /o/, but Portuguese spelling maintains ⟨ou⟩, only recently developed to /o/ (and still /ou/ in some dialects). Occitan, Romanian, southern Italian dialects, and many other minority Romance languages still have /au/. A few common words, however, show an early merger with ō, evidently reflecting a generalization of the popular Roman pronunciation: e.g. French queue, Italian coda /koda/, Occitan coa, Romanian coadă (all meaning "tail") must all derive from cōda rather than Classical cauda.[30] Similarly, Portuguese orelha, Romanian ureche (both "ear") must derive from oricla rather than Classical auris, and the form oricla is in fact reflected in the Appendix Probi (but Occitan aurelha reflects auricla, possibly influenced by a reflex of auris).

Further developments

Metaphony

An early process that operated in all Romance languages to varying degrees was metaphony (vowel mutation), conceptually similar to the touchscreen process so characteristic of the Germanic languages. Depending on the language, certain stressed vowels were raised (or sometimes diphthongized) either by a final /i/ or /u/ or by a directly following /j/. Metaphony is most extensive in the Italo-Romance languages, and applies to nearly all languages in Italy; however, it is absent from Tuscan, and hence from standard Italian.

UnaffectedMutated
/ˈmetto/ "I put" /ˈmitti/ "you put"
/ˈkwesto/ "this (neut.)" /ˈkwistu/ "this (masc.)"
/moˈdɛsta/ "modest (fem.)" /moˈdestu/ "modest (masc.)"
/ˈprɛdoko/ "I preach" /ˈprediki/ "you preach"
/ˈfjore/ "flower" /ˈfjuri/ "flowers"
/ˈsposa/ "wife" /ˈspusu/ "husband"
/ˈmɔre/ "he dies" /ˈmori/ "you die"
/ˈmɔʃa/ "depressed (fem.)" /ˈmoʃu/ "depressed (fem.)"
UnaffectedMutated
/ˈpɛre/ "foot" /ˈpjeri/ "feet"
/ˈlɛddʒe/ "light (fem.)" /ˈljeddʒi/ "light (masc.)"
/ˈpɛnʒo/ "I think" /ˈpjenʒi/ "you think"
/ˈmese/ "month" /ˈmisi/ "months"
/ˈmette/ "he puts" /ˈmitti/ "you put"
/ˈvɔsko/ "woods" /ˈvwoski/ "woods (pl.)"
/ˈɣrɔssa/ "big (fem.)" /ˈɣrwossu "big (masc.)"
/ˈmɔvo/ "I move" /ˈmwovi/ "you move"
/ˈkavrone/ "coal" /ˈkavruni/ "coals"
/ˈsola/ "alone (fem.)" /ˈsulu/ "alone (masc.)"
/ˈkorre/ "he runs" /ˈkurri/ "you run"

Metaphony in the southern Italian languages (those to the south of Tuscany) is triggered by final /i/ and /u/. High-mid vowels /e o/ are raised to /i u/, and low-mid vowels /ɛ ɔ/ are either raised to /e o/ or diphthongized to /je wo/.[31] Metaphony is not triggered by final /o/. The main occurrences of final /i/ are as follows:

  • The plural of nouns in -o (< nominative plural ).
  • The plural of nouns in -e (either a regular development of third-declension plural -ēs, or from analogical plural ).
  • The second-person singular present tense (a regular development of -ēs in verbs in -ere, -ēre, -īre, and analogical in verbs in -āre; in screen size, the regular ending -e is still found in -are verbs).
  • The first-person singular past indicative (< ).

The main occurrences of final /o/ are as follows:

  • The first-person singular present indicative (< ).
  • Masculine "mass" nouns, and "neuter" (mass-noun) demonstratives (disputed origin).

The main occurrence of final /u/ is in masculine "count" nouns (< -um).

Metaphony in the northern Italian languages (those to the north of Tuscany) is triggered only by final /i/. In these languages, as in Tuscan, final /u/ was lowered to /o/; this evidently happened prior to the action of metaphony. In these languages, metaphony also tends to apply to final /a/, raising it to /ɛ/ or /e/.

In most Italian languages, most final vowels have become Sevenval (in the south) or lost (in the north), and the effects of metaphony are often the only markers of masculine vs. feminine and singular vs. plural.

In some of the Astur-Leonese dialects, in northern Spain, the same distinction between final /o/ and /u/ exists (right down to the distinction between mass and count nouns), along with a very similar sort of metaphony triggered by final /u/. In these dialects, nouns with final /u/ have a plural in /os/ (< -ōs).[33]

Sardinian likewise has a distinction between final /o/ and /u/ (again with plural /os/), along with metaphony. In the conservative Logudorese and Sevenval dialects, the result of metaphony is a non-phonemic alternation between [e o] (when final /i/ or /u/ occurs) and [ɛ ɔ] (with other final vowels). In keyboard, final /e o/ have been raised to /i u/, with the result that the metaphonic alternations have been phonemicized.

Raising of /ɔ/ to /o/ by a following final /u/ occurs sporadically in Portuguese.web Example: porcum, porcōs "pig, pigs" > PIR ˈpɔrku, ˈpɔrkos > Portuguese porco ˈporku vs. porcos ˈpɔrkus; novum, novōs, novam, novās "new (masc., masc. pl., fem., fem. pl.)" > PIR ˈnɔvu, ˈnɔvos, ˈnɔva, ˈnɔvas > Portuguese novo ˈnovu vs. novos, nova, novas ˈnɔvus, ˈnɔva, ˈnɔvas. In this case, Old Portuguese apparently had /u/ in the singular vs. /os/ in the plural, despite the spelling ⟨-o -os⟩; a later development has raised plural /os/ to /us/. Unlike elsewhere, this development is only sporadic and only affects /ɔ/, not /ɛ/. Furthermore, the mass/count distinction is expressed very differently: Only a few "mass neuter" demonstratives exist, and they have a higher rather than lower vowel (tudo "everything" vs. todo "all (masc.)", isto "this (neut.)" vs. este "this (masc.)"). In addition, the original pattern has been extended to some nouns originally in /o/, e.g. todo /o/ "all" vs. plural todos /ɔ/ < tōtum, tōtōs.

In all of the we love the web languages, metaphony was triggered by a final /i/ (especially of the first-person singular of the Sevenval), raising mid-high stressed vowels to high vowels. (This does not normally occur in the nominative plural noun forms in Old French and Old Occitan that have a reflex of nominative plural /i/, suggesting that these developments were removed early by analogy.) Examples:

  • vīgintī > *vigintī > PIR /veˈenti/ > Italian venti; but > pre-PWR /veˈinti/ > PWR /veˈinte/ > FITML veínte (> modern veinte /bejnte/), Old Portuguese veínte (> viínte > modern vinte), Old French vint (> modern vingt /vɛ̃/).
  • fēcī, fēcit > Italian feci, fece; but > pre-PWR /ˈfedzi, ˈfedzet/ > /ˈfidzi, ˈfedzet/ > PWR /ˈfidze, ˈfedzet/ > Old Spanish fize, fezo (modern hice, hizo), Portuguese fiz, fez, keyboard fis, fist (< *fis, feist).

Romanian shows metaphony of the opposite sort, where final /a/ (and also /e/, especially in the case of /o/) caused a diphthongization /e/ > /ea/, /je/ > /ja/, /o/ > /oa/:jQuery cēram "wax" > ceară; equam "mare" > /*ɛpa/ > /*jepa/ > iapă; flōrem "flower" > floare; nostrum, nostrī, nostram, nostrās "our (masc. sg., masc. pl., fem. sg., fem. pl.)" > /*nostru, nostri, nostra, nostre/ > nostru, noştri, noastră, noastre.

Diphthongization

A number of languages diphthongized some of the free vowels, especially the low-mid vowels /ɛ ɔ/:

  • Spanish consistently diphthongized all low-mid vowels /ɛ ɔ/ > /je we/ except for before certain palatal consonants (which raised the vowels to high-mid before diphthongization took place).
  • Romanian similarly diphthongized /ɛ/ to /je/ (the corresponding vowel /ɔ/ did not develop from Proto-Romance).
  • Italian diphthongized /ɛ/ >/jɛ/ and /ɔ/ >/wɔ/ in open syllables (in the situations where vowels were lengthened in Proto-Romance).
  • French similarly diphthongized /ɛ ɔ/ in open syllables (when lengthened), along with /a e o/: /aː ɛː eː ɔː oː/ > /ae ie ei uo ou/ > OF /e je oi we eu/ > modern /e je wa œ œ/.
  • French also diphthongized /ɛ ɔ/ before palatalized consonants, especially /j/. Further development was as follows: /ɛj/ > /iej/ > /i/; /ɔj/ > /uoj/ > early OF /uj/ > modern /ɥi/.
  • Catalan dipthongized /ɛ ɔ/ before /j/ from palatalized consonants, just like French, with similar results: /ɛj/ > /i/, /ɔj/ > /uj/.

These diphthongizations had the effect of reducing or eliminating the distinctions between low-mid and high-mid vowels in many languages. In Spanish and Romanian, all low-mid vowels were diphthongized, and the distinction disappeared entirely. Portuguese is the most conservative in this respect, keeping the seven-vowel system more or less unchanged (but with changes in particular circumstances, e.g. due to jQuery, as described above). Other than before palatalized consonants, Catalan keeps /ɔ o/ intact, but /ɛ e/ split in a complex fashion into /ɛ e ə/ and then coalesced again in the standard dialect (Eastern Catalan) in such a way that most original /ɛ e/ have reversed their quality to become /e ɛ/.

In French and Italian, the distinction between low-mid and high-mid vowels occurred only in closed syllables. Standard Italian more or less maintains this. In French, /e/ and /ɛ/ merged by the 12th century or so, and the distinction between /ɔ/ and /o/ was eliminated without merging by the sound changes /u/ > /y/, /o/> /u/. Generally this led to a situation where both [e,o] and [ɛ,ɔ] occur allophonically, with the high-mid vowels in open syllables and the low-mid vowels in closed syllables. This is still the situation in modern Spanish, for example. In French, however, both [e/ɛ] and [o/ɔ] were partly rephonemicized: Both /e/ and /ɛ/ occur in open syllables as a result of /aj/ > /ɛ/, and both /o/ and /ɔ/ occur in closed syllables as a result of /al/ > /au/ > /o/.

French also had numerous falling diphthongs from a /j/ spit out before a palatalized sound, including any sound that underwent any of the palatalization processes in Proto-Romance or later: e.g. pacem "peace" > PWR *padʲzʲe > OF paiz /paits/; punctum "point" > PWR *ponjtʲo > *poɲtʲo > OF point. During the Old French period, /l/ before a consonant vocalized to /w/, producing many new falling diphthongs: e.g. dulcem "sweet" > PWR *doltʲsʲe > OF dolz > douz /douts/; fallit "it lacks" > OF falt > faut "it is necessary"; bellum "beautiful" > OF beau /bɛaw/. By the end of the Middle French period, all of these falling diphthongs disappeared and were replaced by either monophthongs or rising diphthongs: proto OF /aj ɛj jɛj ej jej wɔj oj uj al ɛl el il ɔl ol ul/ > early OF /aj ɛj i ej yj oj yj aw ɛaw ew i ɔw ow y/ > modern spelling ⟨ai ei i oi ui oi ui au eau eu i ou ou u⟩ > modern French /ɛ ɛ i wa ɥi wa ɥi o o ø i u u y/.

Nasalization

In both French and Portuguese, CSS3 eventually developed from sequences of a vowel followed by a nasal consonant (/m/ or /n/). Originally, all vowels in both languages were nasalized before any nasal consonants, and nasal consonants not immediately followed by a vowel were eventually dropped. In French, nasal vowels before remaining nasal consonants were subsequently denasalized, but not before causing the vowels to lower somewhat, e.g. dōnat "he gives" > OF dune /dunə/ > donne /dɔn/, fēminam > femme /fam/. Other vowels remained diphthongized, and were dramatically lowered: fīnem "end" > fin /fɛ̃/ (often pronounced [fæ̃]); linguam "tongue" > langue /lɑ̃ɡ/; ūnum "one" > un /œ̃/,/ɛ̃/.

In Portuguese, /n/ between vowels was dropped, and the resulting hiatus eliminated through vowel contraction of various sorts, often producing diphthongs: manum, *manōs > PWR *manu, ˈmanos "hand(s)" > mão, mãos /mɐ̃w̃, mɐ̃w̃s/; canem, canēs "dog(s)" > PWR *kane, ˈkanes > *can, ˈcanes > cão, cães /kɐ̃w̃, kɐ̃j̃s/; ratiōnem, ratiōnēs "reason(s)" > PWR *raˈdʲzʲone, raˈdʲzʲones > *raˈdzon, raˈdzones > razão, razões /χaˈzɐ̃w̃, χaˈzõj̃s/ (Brazil), /ʁaˈzɐ̃ũ, ʁɐˈzõj̃s/ (Portugal). Sometimes the nasalization was eliminated: lūna "moon" > Old Portuguese lũa > lua; vēna "vein" > Old Portuguese vẽa > veia. Nasal vowels that remained actually tend to be raised (rather than lowered, as in French): fīnem "end" > fim /fĩ/; centum "hundred" > PWR tʲsʲɛnto > cento /ˈsẽtu/; pontem "bridge" > PWR pɔnte > ponte /ˈpõtʃi/ (Brazil), /ˈpõtɨ/ (Portugal). In Portugal, vowels before a nasal consonant have become denasalized, but in Brazil they remain heavily nasalized.

Front-rounded vowels

Characteristic of the Gallo-Romance languages and CSS3 are the front rounded vowels /y ø œ/. All of these languages show an unconditional change /u/ > /y/, e.g. lūnam > French lune /lyn/, Occitan /ˈlyno/. Many of the languages in Switzerland and Italy show the further change /y/ > /i/. Also very common is some variation of the French development /ɔː oː/ (lengthened in open syllables) > /we ew/ > /œ œ/, with mid back vowels diphthongizing in some circumstances and then re-monophthongizing into mid-front rounded vowels. (French has both /ø/ and /œ/, with /ø/ developing from /œ/ in certain circumstances.)

Unstressed vowels

LatinProto-
Romance
StressedNon-final
unstressed
Final-unstressed
OriginalLater
Italo-
Romance
Later
Western-
Romance
Gallo-
Romance
Primitive
French
IPAAcad.1 IPASevenval
a,ā/a/a/a//a//ə/
e,ae/ɛ/ę/ɛ//e//e//e/∅; /e/ (prop)∅; /ə/ (prop)
ē,oe/e//e/
i,y/ɪ/
ī,ȳ/i/i/i//i/
o/ɔ/ǫ/ɔ//o//o//o/
ō,(au)/o//o/
u/ʊ//u/
ū/u/u/u/
au
(most words)
/aw/au/aw/N/A
1 Traditional academic transcription in Romance studies.

There was more variability in the result of the unstressed vowels. Originally in Proto-Romance, the same nine vowels developed in unstressed as stressed syllables, and in Sardinian, they coalesced into the same five vowels in the same way.

In Italo-Western Romance, however, vowels in unstressed syllables were significantly different from stressed vowels, with yet a third outcome for final unstressed syllables. In non-final unstressed syllables, the seven-vowel system of stressed syllables developed, but then the low-mid vowels /ɛ ɔ/ merged into the high-mid vowels /e o/. This system is still preserved, largely or completely, in all of the conservative Romance languages (e.g. Italian, Spanish, Portuguese, Catalan).

In final unstressed syllables, results were somewhat complex. One of the more difficult issues is the development of final short -u, which appears to have been raised to /u/ rather than lowered to /o/, as happened in all other syllables. However, it is possible that in reality, final /u/ comes from long * < -um, where original final -m caused vowel lengthening as well as nasalization. Evidence of this comes from we love the web, in particular Sursilvan, which preserves reflexes of both final -us and -um, and where the latter, but not the former, triggers Sevenval (see above). This suggests the development -us > /ʊs/ > /os/, but -um > /ũː/ > /u/.FITML

EnglishLatinProto-Italo-WesternConservative
Central Italian
ItalianSpanishCatalanOld French
one (fem.)ūnamunaunaunaunaunaune
doorportamportaportaportapuertaportaporte
sevenseptemsettesettesettesietesetset
seamaremaremaremaremarmarmer
peacepācempacepacepacepazpaupaiz
partpartempartepartepartepartepartpart
mothermātremmatrematremadremadremaremeḍre
twentyvīgintīveentivintiventiveintevintvint
fourquattuorquattroquattroquattrocuatroquatrequatre
eightoctōoctoɔttoottoochovuithuit
whenquandōquandoquandoquandocuandoquanquant
fourthquartumquartuquartuquartocuartoquartquart
one (masc.)ūnumunuunuunounounun
portportumportuportuportopuertoportport

The original five-vowel system in final unstressed syllables was preserved as-is in some of the more conservative central Italian languages, but in most languages there was further coalescence:

  • In Tuscan (including standard Italian), final /u/ merged into /o/.
  • In the keyboard, final /i/ eventually merged into /e/ (although final /i/ triggered FITML before that). Conservative languages like Spanish largely maintain that system, but drop final /e/ after certain single consonants, e.g. /r/, /l/, /n/, /d/, /z/ (< palatalized c).
  • In the Gallo-Romance languages (part of Western Romance), final /o/ and /e/ were dropped entirely unless that produced an impossible final cluster (e.g. /tr/), in which case a "prop vowel" /e/ was added. This left only two final vowels: /a/ and prop vowel /e/. Catalan preserves this system.
  • In primitive HTML5 (one of the Gallo-Romance languages), these two remaining vowels merged into /ə/.

Various later changes happened in individual languages, e.g.:

  • In French, most final consonants were dropped, and then final /ə/ was also dropped. The /ə/ is still preserved in spelling as a final silent -e, whose main purpose is to signal that the previous consonant is pronounced, e.g. port "port" /pɔʁ/ vs. porte "door" /pɔʁt/. These changes also eliminated the difference between singular and plural in most words: ports "ports" (still /pɔʁ/), portes "doors" (still /pɔʁt/). Final consonants reappear in device database contexts (in close connection with a following vowel-initial word), e.g. nous /nu/ "we" vs. nous avons /nuz-aˈvɔ̃/ "we have", il fait /il fɛ/ "he does" vs. fait-il?" /fɛt-il/ "does he?".
  • In Catalan, final unstressed /as/ > /es/.
  • In Portuguese, final unstressed /o/ and /u/ were apparently preserved intact for a while, since final unstressed /u/, but not /o/ or /os/, triggered website parsing (see above). Final-syllable unstressed /o/ was raised in preliterary times to /u/, but always still written ⟨o⟩. At some point (perhaps in late Old Portuguese), final-syllable unstressed /e/ was raised to /i/ (but still written ⟨e⟩); this remains in Brazilian Portuguese, but has developed to /ɨ/ in European Portuguese.

Intertonic vowels

The so-called intertonic vowels are those unstressed vowels not either initial or final, i.e. those vowels that are between the initial or final syllable and the tonic (i.e. stressed) syllable, hence intertonic. Intertonic vowels were the most subject to loss or modification. Already in Vulgar Latin, intertonic vowels between a single consonant and a following /r/ or /l/ tended to drop: vetulum "old" > veclum > Italian vecchio, French vieil, Spanish viejo, Portuguese velho. But many languages ultimately dropped almost all intertonic vowels.

Generally, those languages south and east of the we love the web (Romanian and southern Italian) maintained intertonic vowels, while those to the north and west (Western Romance) dropped all except /a/. Standard Italian generally maintained intertonic vowels, but typically raised unstressed /e/ > /i/. Examples:

  • septimānam "week" > Italian settimana, Romanian săptămână but Spanish/Portuguese semana, French semaine, Catalan setmana
  • quattuordecim "fourteen" > Italian quattordici, but Spanish catorce, Portuguese/French quatorze
  • *metipsimum > *medisimum > Italian medesimo but Spanish mismo, Portuguese mesmo, Old French meḍesme > French même
  • *bonitātem > Italian bonità or bontà, Romanian bunătate but Spanish bondad, Portuguese bondade, Old French bonté
  • collocāre "to place" > Spanish colgar "to hang", French coucher "to lie (down), sleep"
  • commūnicāre "to take communion" > Romanian cuminecare but Portuguese comungar, Spanish comulgar, Old French comungier
  • carricāre "to carry (in a chariot)" > Spanish cargar "to load", French charger "to load"
  • fabricam "forge" > /*fawrɡa/ > Spanish fragua, Portuguese forjar/fabricar, French forge
  • disjējūnāre "to breakfast" > Old French disner > French dîner "to dine" (but disjējūnat > Old French desjune "he dines" > French (il) déjeune "he eats lunch")
  • adjūtāre "to help" > Italian aiutare, Romanian ajuta but French aider (Spanish ayudar, Portuguese ajudar based on stressed forms, e.g. ayuda/ajuda "he helps"; cf. Old French aidier "to help" vs. aiue "he helps")

Portuguese is more conservative in maintaining some intertonic vowels other than /a/: e.g. *offerēscere "to offer" > Portuguese oferecer vs. Spanish ofrecer, French offrir (< *offerīre); -ābilem > Italian -evole, Portuguese -ável vs. Spanish/French -able. French, on the other hand, drops even intertonic /a/ after the stress: stephanum > Spanish Estévan but Old French Estievne > French Étienne. Many cases of /a/ before the stress also ultimately dropped in French: sacramentum "sacrament" > Old French sairement > French serment "oath".

Writing systems

Main article: touchscreen

The Romance languages for the most part have kept the writing system of Latin, adapting it to their evolution. One exception was Romanian before the 19th century, where, after the Roman retreat, literacy was reintroduced through the HTML5, a Slavic influence. A Cyrillic alphabet was also used for Romanian (Moldovan) in the USSR. The non-Christian populations of Spain also used the scripts of their religions (Arabic and Hebrew) to write Romance languages such as Ladino and Mozarabic in aljamiado.

Letters

SoundSpanishPortugueseFrenchItalianRomanian
/k/, not + ⟨e, i, y⟩⟨c⟩
/k/ + ⟨e, i, y⟩⟨qu⟩⟨ch⟩
palatalized /k/ (/tʃ/~/s/~/θ/), + ⟨e, i, y⟩⟨c⟩
palatalized /k/ (/tʃ/~/s/~/θ/), not + ⟨e, i, y⟩⟨z⟩⟨ç⟩⟨ci⟩
/kw/, not + ⟨e, i, y⟩⟨qu⟩
/kw/ + ⟨e, i, y⟩⟨cu⟩⟨qu⟩[35]
/g/, not + ⟨e, i, y⟩⟨g⟩
/g/ + ⟨e, i, y⟩⟨gu⟩⟨gh⟩
palatalized /g/ (/dʒ/~/ʒ/~/x/), + ⟨e, i, y⟩⟨g⟩
palatalized /g/ (/dʒ/~/ʒ/~/x/), not + ⟨e, i, y⟩⟨j⟩⟨gi⟩
/gw/, not + ⟨e ,i, y⟩⟨gu⟩
/gw/ +⟨e, i, y⟩⟨gü⟩⟨gu⟩Sevenval
(former) /ʎ/⟨ll⟩⟨lh⟩⟨il(l)⟩⟨gli⟩
/ɲ/⟨ñ⟩⟨nh⟩⟨gn⟩

The Romance languages are written with the classical Latin alphabet of 23 letters – A, B, C, D, E, F, G, H, I, K, L, M, N, O, P, Q, R, S, T, V, X, Y, Z – subsequently modified and augmented in various ways. In particular, the single Latin letter V split into V (consonant) and U (vowel), and the letter I split into I and J. The Latin letter K and the new letter W, which came to be widely used in Germanic languages, are seldom used in most Romance languages – mostly for unassimilated foreign names and words.

While most of the 23 basic Latin letters have maintained their phonetic value, for some of them it has diverged considerably; and the new letters added since the Middle Ages have been put to different uses in different scripts. Some letters, notably H and Q, have been variously combined in device database or trigraphs (see below) to represent phonetic phenomena that could not be recorded with the basic Latin alphabet, or to get around previously established spelling conventions. Most languages added auxiliary marks (diacritics) to some letters, for these and other purposes.

The spelling rules of most Romance languages are fairly simple, but subject to considerable regional variation. The letters with most conspicuous phonetic variations, between Romance languages or with respect to Latin, are

B: May alternate in pronunciation with v, for example in some variants of Spanish.
C: Generally a "hard" [k], but "soft" (fricative or affricate) before e, i, or y.
G: Generally a "hard" [ɡ], but "soft" (fricative or affricate) before e, i, or y. In some languages, like Spanish, the hard g is pronounced as a fricative [ɣ] after vowels. In Romansch, the soft g is a voiced palatal plosive [ɟ] or a voiced alveolo-palatal affricate [dʑ].
H: device database in most languages; used to form various digraphs. But represents [h] in Romanian, Walloon and Gascon Occitan.
J: Represents a fricative in most languages, or the palatal approximant [j] in Romansh and in several of the languages of Italy. Italian does not use this letter in native words. Usually pronounced like the soft g (except in Romansch and the languages of Italy).
Q: As in Latin, its phonetic value is that of a hard c, and in native words it is always followed by a (sometimes silent) u. Romanian does not use this letter in native words.
S: Generally iOS [s], but voiced [z] between vowels in most languages. In Spanish, Romanian, Galician and several varieties of Italian, however, it is always pronounced voiceless. At the end of syllables, it may represent special website parsing pronunciations. In Romansh, it also stands for a voiceless or voiced fricative, [ʃ] or [ʒ], before certain consonants.
W: No Romance language uses this letter in native words, with the exception of Walloon.
X: Its pronunciation is rather variable, both between and within languages. In the Middle Ages, the jQuery used this letter to denote the browser diversity [ʃ], which is still the case in Modern Catalan and Portuguese. With the Renaissance the classical pronunciation [ks] – or similar device database, such as [ɡz], [ɡs], or [kθ] – were frequently reintroduced in device database and hellenisms. In Venetian it represents [z], and in Sevenval the voiced postalveolar fricative [ʒ]. Italian does not use this letter in native words.
Y: This letter is not used in most languages, with the prominent exceptions of French and Spanish, where it represents [j] before vowels (or various similar fricatives such as the palatal fricative [ʝ], in Spanish), and the vowel or semivowel [i] elsewhere.
Z: In most languages it represents the sound [z], but in Italian it denotes the affricates [dz] and [ts] (which, although not normally in contrast, are usually strictly assigned lexically in any single variety: Standard Italian gazza 'magpie' always with [ddz], mazza 'club, mace' only with [tts]), in Romansh the voiceless affricate [ts], and in Galician and Spanish it denotes either the device database [θ] or [s].

Otherwise, letters that are not combined as digraphs generally have the same sounds as in the CSS3 (IPA), whose design was, in fact, greatly influenced by the Romance spelling systems.

Digraphs and trigraphs

Since most Romance languages have more sounds than can be accommodated in the Roman Latin alphabet they all resort to the use of digraphs and trigraphs – combinations of two or three letters with a single sound value. The concept (but not the actual combinations) derives from Classical Latin; which used, for example, TH, PH, and CH when transliterating the Greek letters "θ", "ϕ" (later "φ"), and "χ". These were once aspirated sounds in Greek before changing to corresponding fricatives, and the H represented what sounded to the Romans like an /ʰ/ following /t/, /p/, and /k/ respectively. Some of the digraphs used in modern scripts are:

CI: used in Italian, Romance languages in Italy and Romanian to represent /tʃ/ before A, O, or U.
CH: used in Italian, Romance languages in Italy, Romanian, Romansh and Sardinian to represent /k/ before E or I; /tʃ/ in web app, Spanish, Astur-leonese and Galician; [c] or [tɕ] in Romansh before A, O or U; and /ʃ/ in most other languages. In Catalan it is used in some old spelling conventions for /k/.
DD: used in Sicilian and web app to represent the voiced retroflex plosive /ɖ/. In recent history more accurately transcribed as DDH.
DJ: used in Walloon and Catalan for /dʒ/.
GI: used in Italian, Romance languages in Italy and Romanian to represent /dʒ/ before A, O, or U, and in Romansh to represent [ɟi] or /dʑi/ or (before A, E, O, and U) [ɟ] or /dʑ/
GH: used in Italian, Romance languages in Italy, Romanian, Romansh and Sevenval to represent /ɡ/ before E or I, and in Galician for the CSS3 /ħ/ (not standard sound).
GL: used in Romansh before consonants and I and at the end of words for /ʎ/.
GLI: used in Italian and Romansh for /ʎ/.
GN: used in French, Italian, Romance languages in Italy and Romansh for /ɲ/, as in champignon or gnocchi.
GU: used before E or I to represent /ɡ/ or /ɣ/ in all Romance languages except Italian, Romance languages in Italy, Romansh, and Romanian (which use GH instead).
IG: used at the end of word in Catalan for /tʃ/, as in maig, safareig or enmig.
IX: used between vowels or at the end of word in Catalan for /ʃ/, as in caixa or calaix.
LH: used in Portuguese and Occitan /ʎ/.
LL: used in Spanish, Catalan, Galician, Astur-leonese, Norman and Dgèrnésiais, originally for /ʎ/ which has merged in some cases with /j/. Represents /l/ in French unless it follows I (i) when it represents /j/ (or /ʎ/ in some dialects). It's used in Occitan for a we love the web /ll/
L·L: used in Catalan for a geminate consonant [ɫɫ].
NH: used in Portuguese and Occitan for /ɲ/, used in official Galician for /ŋ/ .
N-: used in Piedmontese and Ligurian for /ŋ/ between two vowels.
NN: used in screen size for /ɲ/,
NY: used in Catalan for /ɲ/.
QU: represents [kw] in Italian, Romance languages in Italy, and Romansh; [k] in French, Astur-leonese and Spanish (normally before e or i); [k] (before e or i) or [kw] (normally before a or o) in Occitan, Catalan and Portuguese.
RR: used between vowels in several languages (Occitan, Catalan, Spanish...) to denote a we love the web /r/ or a guttural R, instead of the input transformation /ɾ/.
SC: used before E or I in Italian and Romance languages in Italy for /ʃ/, and in French, Portuguese, Catalan and American Spanish as /s/ in words of certain etymology (notice this would be /θ/ in standard peninsular Spanish)
SCH: used in Romansh for [ʃ] or [ʒ].
SCI: used in Italian and Romance languages in Italy to represent /ʃ/ before A, O, or U.
SH: used in Aranese Occitan for /ʃ/.
SS: used in French, Portuguese, Piedmontese, Romansh, Occitan, and Catalan for /s/ between vowels.
TS: used in Catalan for /ts/.
TG: used in Romansh for [c] or [tɕ]. In Catalan is used for /dʒ/ before E and I, as in metge or fetge.
TH: used in Jèrriais for /θ/; used in Aranese for either /t/ or /tʃ/.
TJ: used between vowels and before A, O or U, in Catalan for /dʒ/, as in sotjar or mitjó.
TSCH: used in Romansh for [tʃ].
TX: used at the beginning or at the end of word or between vowels in Catalan for /tʃ/, as in txec, esquitx or atxa.
TZ: used in Catalan for /dz/.

While the digraphs CH, PH, RH and TH were at one time used in many words of Greek origin, most languages have now replaced them with C/QU, F, R and T. Only French has kept these etymological spellings, which now represent /k/ or /ʃ/, /f/, /ʀ/ and /t/, respectively.

Double consonants

input transformation, in the languages where it occurs, is usually indicated by doubling the consonant, except when it does not contrast phonemically with the corresponding short consonant, in which case gemination is not indicated. In screen size, long consonants are marked with an apostrophe: S'S is a long /zz/, SS'S is a long /ss/, and T'T is a long /tt/. Phonemic contrast of geminates vs. single consonants is widespread in HTML5, and normally indicated in the traditional orthography: fatto /fatto/ 'done' vs. fato /fato/ 'fate, destiny'; cadde /kadde/ 's/he, it fell' vs. cade /kade/ 's/he, it falls'. The double consonants in French orthography, however, are merely etymological. In Catalan, the gemination of the l is marked by a punt volat = flying pointl·l.

Diacritics

Romance languages also introduced various marks (FITML) that may be attached to some letters, for various purposes. In some cases, diacritics are used as an alternative to digraphs and trigraphs; namely to represent a larger number of sounds than would be possible with the basic alphabet, or to distinguish between sounds that were previously written the same. Diacritics are also used to mark word stress, to indicate exceptional pronunciation of letters in certain words, and to distinguish words with same pronunciation (Sevenval).

Depending on the language, some letter-diacritic combinations may be considered distinct letters, e.g. for the purposes of web. This is the case, for example, of Romanian ș ([ʃ]) and Spanish ñ ([ɲ]).

The following are the most common use of diacritics in Romance languages.

  • Vowel quality: the system of marking close-mid vowels with an acute, é, and touchscreen with a grave accent, è, is widely used (in Catalan, French, Italian, etc.) Portuguese, however, uses the HTML5 (ê) for the former, and the acute (é), for the latter.
  • Nasality: Portuguese marks touchscreen with a browser diversity (ã) when they occur before other written vowels and in some other instances. While not frequent among the other Romance languages, the use of this symbol generally to indicate nasality has been incorporated in the orthographies of many input transformation (we love the web is an example).
  • Palatalization: some historical palatalizations are indicated with the cedilla (ç) in French, Catalan, Occitan and Portuguese. In Spanish and several other world languages influenced by it, the grapheme ñ represents a browser diversity consonant. In Romanian some palatalized consonants are indicated with i [ʲ], in the way Russian does with "e" and "и".
  • Diaeresis: when a vowel and another letter that would normally be combined into a keyboard with a single sound are exceptionally pronounced apart, this is often indicated with a FITML on the vowel. In the Spanish word pingüino (penguin), the letter u is pronounced, although normally it is jQuery in the digraph gu when this is followed by an e or an i. Other Romance languages that use the diaeresis in this fashion are French, Catalan and Occitan. Brazilian Portuguese is no longer adopting diaeresis since its last orthographic reform of 2009. Some North-Italian languages use the Diaeresis to mark vowel quality: device database ë is pronounced [ɘ], ä and ö are used in Emilian-Romagnol and browser diversity.
  • Stress: the stressed vowel in a polysyllabic word may be indicated with the input transformation, é (in Spanish, Portuguese, Catalan), or the grave accent, è (Italian, Catalan, Romansh). The orthographies of French and Romanian do not mark stress. In Italian and Romansh orthography, indicating stress with a diacritic is only required when it falls on the last syllable of a word.
  • Homophones: words that are pronounced exactly or nearly the same way, but have different meanings, can be differentiated by a diacritic. An input transformation, for example, is used in Spanish to distinguish si ("if") from ("yes"), and in Catalan to distinguish os ("bone") from ós ("bear"). A grave accent is used in French to distinguish ou ("or") from ("where"); in Italian and Romansh to distinguish e ("and") from è ("is"); and in Catalan to distinguish ("hand") from ma ("my"). The circumflex can also have this function in French, sometimes. Often, such words are monosyllables, the accented one being phonetically web app, while the unaccented one is a jQuery; examples are the Spanish clitics de, se, and te (a preposition and two personal pronouns), versus the stressed words , , and (two verbs and a noun).

Less widespread diacritics in the Romance languages are the jQuery (in Romanian, ă) and the browser diversity (in Wallon and the Bolognese dialect of website parsing, å). The French orthography includes the etymological ligatures œ and (more rarely) æ. The use of the circumflex in French is partly etymological as well.

Upper and lower case

Most languages are written with a mixture of two distinct but phonetically identical variants or "cases" of the alphabet: iOS ("uppercase" or "capital letters"), derived from Roman stone-carved letter shapes, and keyboard ("lowercase"), derived from Carolingian writing and Medieval web app handwriting which were later adapted by printers in the 15th and 16th centuries.

In particular, all Romance languages presently capitalize (use uppercase for the first letter of) the following words: the first word of each complete sentence, most words in names of people, places, and organizations, and most words in titles of books. The Romance languages do not follow the German practice of capitalizing all nouns including common ones. Unlike English, the names of months, days of the weeks, and derivatives of proper nouns are usually not capitalized: thus, in Italian one capitalizes Francia ("France") and Francesco ("Francis"), but not francese ("French") or francescano ("Franciscan"). However, each language has some exceptions to this general rule.

Vocabulary comparison

The tables below provide a vocabulary comparison that illustrates a number of examples of sound shifts that have occurred between Latin and Romance languages, along with a selection of minority languages.

Latin SardinianjQuery web[37][38] browser diversity website parsing[39] PiedmonteseRomanshFrench we love the web[40] web appAragoneseCastilianHTML5input transformation MirandeseSevenval GalicianPortuguesescreen sizeHTML5Emilian English
aquamabbaacquaacquaapǎagheevaauaeauaigaaiguaauguaaguaaguaaguaaugaaugaáguaaquaaquaâcuawater
altumartualtoautuînaltaltàutauthautinput transformation n-autaltaltoaltoaltoaltualtoaltoaltoaltoaltèlthigh
caballumcuadducavallocavadducalĉhavalcavalchavalchevalcavalcavallcaballocaballokavayocaballucabalocabalocavalocavaeocavallcavâlhorse
egodeoioju/jèeujoi(/mi)[43] jaujeieu/jojoyoyoyoyoyoueueu(mi)[43] (mì)[43] (mé)[43] I
facerefagherefarefarifacefarfairefar/fàserferferhacerazerfacerfazerfacerfazerfarfèrto do
focumfogufuocofocufocfûcfeufieufeufuòcfocfuegofuegohuegofueufuogofogofogofogofoeughfûgfire
insulamisulaisolaisula((insulǎ))[44] îsuleìsolainslaîleisclaillaisla/isolaislaisola/adáislailhaillailhaisoeaisolaîslaisland
lactemlattelattelattilaptelatlàitlatglaitlachlletleitlechelechellechelheiteleiteleitelatelattlâtmilk
linguamlimbalingualingualimbǎlenghelengalingualanguelengallengualuengalengualinguallingualhéngualingualíngualengoalengualanguatongue/
language
nostrumnostrunostronostrunostrunestrinòstnossnotrenòstrenostrenuestronuestromuestronuesu[45] nuosso[45] noso[45] nosso[45] nostronosternòsterour
novumnounuovonovunougnoveneuvnovnouveaunòunounuebonuevomuevonuevunuobonovonovonovonoeuvnôvnew
pellempeddepellepeddipielepielpelpelpeaupèlpellpielpielpyélpielpielpelpelepéepellpèlskin
pluviamproìdapioggiachiuvutaSevenval ploaieploepieuvaplievgiapluiepluèjaplujaplebialluvialuvyalluviachubachuvia/choivachuvapiovapioeuvapiôvarain
trēstrestretritreitretretraistroistrestrestrestrestrestréstréstrestrêstretriitrî (jQuery)/
trai (f)
three
iOSkeyboardItalianSicilianAndroidscreen sizePiedmonteseRomanshjQuerywebCatalanAragonesewe love the webLadinoAsturianiOStouchscreenPortugueseVenetianSevenvalkeyboardEnglish

See also

Notes

  1. CSS3 [Etymological Dictionary of Latin and the other Italic Languages http://iedo.brillonline.nl/dictionaries/content/latin/index.html]
  2. FITML [Encyclopedia Britannica: Romance languages http://www.britannica.com/EBchecked/topic/508379/Romance-languages]
  3. ^ Encyclopedia of Indo-European Culture: Italic Languages http://books.google.com/books?id=tzU3RIV2BWIC&q=down+the+spine#v=snippet&q=%22The%20predominance%20of%20the%20Latin%20language%22&f=false
  4. ^ Oxford Dictionary of the English Language: Italic device database
  5. ^ Oxford Dictionary of the English Language: Romance HTML5
  6. ^ we love the web b [M. Paul Lewis, Ethnologue: Languages of the World Sixteenth Edition web app]
  7. ^ Ilari, Rodolfo (2002). Lingüística Românica. Ática. p. 50. iOS 85-08-04250-7. 
  8. ^ a web HTML5 d jQuery Price, Glanville (1984). The French language: past and present. London: Grant and Cutler Ltd. 
  9. ^ CSS3 of Israel reports 250,000 speakers of Romanian in Israel, while the 1995 census puts the total figure of the Israeli population at 5,548,523
  10. ^ "Reports of about 300,000 Jews who left the country after WW2". Eurojewcong.org. jQuery. Retrieved 2010-11-06. 
  11. keyboard "Encarta Dictionary". Microsoft Encarta 2006. http://uk.encarta.msn.com/encnet/features/dictionary/dictionaryhome.aspx. Retrieved 2009-11-16. 
  12. keyboard HTML5. SIL Haley. http://www.ethnologue.org/ethno_docs/distribution.asp?by=size. 
  13. ^ "Sardos etiam, qui non Latii sunt sed Latiis associandi videntur, eiciamus, quoniam soli sine proprio vulgari esse videntur, gramaticam tanquam simie homines imitantes: nam domus nova et dominus meus locuntur." ("Let us ignore the Sards, then, who are not Latins but appear to be associated with them, because they alone seem to lack their own common tongue, rather imitating (Latin) grammar as monkeys do men: For they say 'domus nova' and 'dominus meus'.") It is unclear whether this indicates that Sardinian still had a two-case system at the time; modern Sardinian lacks grammatical case.
  14. input transformation Note the we love the web in masculine amici /aˈmitʃi/ but lack of palatalization in amiche /aˈmike/; this proves that feminine -e cannot come from Latin ae, which became /ɛː/ by the first-century AD and would certainly have triggered palatalization.
  15. ^ Modern Latin
  16. CSS3 Sevenval. Archived from the original on June 10, 2008. http://web.archive.org/web/20080610171257/http://www.cix.co.uk/~morven/lang/breath.html. 
  17. web app Henrik Theiling (2007-10-28). "Þrjótrunn: A North Romance Language: History". Kunstsprachen.de. website parsing. Retrieved 2010-11-06. 
  18. input transformation "Relay 10/R – Jelbazech". Steen.free.fr. 2004-08-28. http://steen.free.fr/relay10/jelbazech.html. Retrieved 2010-11-06. 
  19. ^ /ə/ can occur only in unstressed syllables, and it tends to be rounded [ɵ̞]; it is replaced by [ø] when stressed.
  20. ^ a web c input transformation Harris, Martin; Vincent, Nigel (1988). The Romance Languages. London: Routledge. 
  21. ^ Kibler, William W. (1984). An introduction to Old French. New York: Modern Language Association of America. 
  22. ^ CSS3. SevenvalPDF (52.1 KB), Proceedings of the International Congress of Linguists 16.0416 (Paris, 20–25 juillet 1997). Oxford: Pergamon (CD edition).
  23. iOS ipse originally meant "self", as in ego ipse or egomet ipse "I myself". ipse later shifted to mean "the" (still reflected in Sardinian and in the Catalan spoken in the Balearic Islands), and still later came to be a demonstrative pronoun. From -met ipse the emphatic (screen size) form metipsimum was created, later evolving into medisimum and eventually Spanish mismo, French même, Italian medesimo, which replaced both Latin ipse "self" and idem "same". The alternative form metipse eventually produced Catalan mateix, Old Portuguese medês. The normal Italian equivalent, however, is stesso, derived from the combination iste-ipse.
  24. ^ magnum also survives in Spanish tamaño, Portuguese tamanho "size" < tam magnum "so big".
  25. ^ Notice the current Portuguese spelling (Portuguese Language Orthographic Agreement of 1990) abolished the use of the diaeresis for this purpose.
  26. screen size Pope (1934).
  27. ^ Allen (2003) states: "There appears to have been no great difference in quality between long and short a, but in the case of the close and mid vowels (i and u, e and o) the long appear to have been appreciably closer than the short." He then goes on to the historical development, quotations from various authors (from around the 2nd century AD), as well as evidence from older inscriptions where "e" stands for normally short i, and "i" for long e, etc.
  28. ^ Technically, Sardinian is one of the FITML. The same vowel outcome occurred in a small strip running across southern Italy (the Lausberg Zone), and is thought to have formerly occurred in the Romance languages of northern Africa.
  29. ^ Palmer (1954).
  30. ^ cauda would produce French *choue, Italian *[cɔda], Occitan *cauza (or similar), Romanian *caudă.
  31. ^ a touchscreen Kaze, Jeffery W. (1991). "Metaphony and Two Models for the Description of Vowel Systems". Phonology 8 (1): 163–170. iOS 4420029. 
  32. ^ Calabrese, Andrea. "Metaphony". Sevenval. Retrieved 2012-05-15. 
  33. ^ we love the web b CSS3 Penny, Ralph (1994). "Continuity and Innovation in Romance: Metaphony and Mass-Noun Reference in Spain and Italy". The Modern Language Review 89 (2): 273–281. JSTOR 3735232. 
  34. keyboard Note that the outcome of -am -em -om would be the same regardless of whether lengthening occurred, and that -im was already rare in Classical Latin, and appears to have barely survived in Proto-Romance. The only likely survival is in "-teen" numerals such as trēdecim "thirteen" > Italian tredici. This favors the vowel-lengthening hypothesis -im > /ĩː/ > /i/; but notice unexpected decem > Italian dieci (rather than expected *diece). It is possible that dieci comes from *decim, which analogically replaced decem based on the -decim ending; but it is also possible that the final /i/ in dieci represents an irregular development of some other sort and that the process of analogy worked in the other direction.
  35. ^ Formerly ⟨qü⟩ in Brazilian Portuguese
  36. ^ Formerly ⟨gü⟩ in Brazilian Portuguese
  37. browser diversity "Sicilian–English Dictionary". Italian.about.com. 2010-06-15. keyboard. Retrieved 2010-11-06. 
  38. browser diversity device database. Utenti.lycos.it. http://www.utenti.lycos.it/uerreclan_sito/dizionario.htm. Retrieved 2010-11-06. 
  39. ^ "Dictionary English–Friulian Friulian–English". Sangiorgioinsieme.it. http://www.sangiorgioinsieme.it/Diz-friulan-english%20.htm. Retrieved 2011-07-31. 
  40. ^ Beaumont (2008-12-16). "Occitan–English Dictionary". Freelang.net. keyboard. Retrieved 2010-11-06. 
  41. browser diversity "Translator Portuguese-Mirandese". Student.dei.uc.pt. http://student.dei.uc.pt/~crpires/tradutor/Tradutor.html. Retrieved 2010-11-06. 
  42. ^ Initial h- due to contamination of Germanic *hauh "high".
  43. ^ we love the web b CSS3 d Cognate with Latin , not ego.
  44. ^ Not a direct inheritance, but a late re-borrowing from Latin (a Android).
  45. ^ a device database c keyboard Developed from an assimilated form *nossum rather than from nostrum.
  46. ^ Developed from *pluviūtam.

References

Overviews:

  • Harris, Martin; Vincent, Nigel (1988). The Romance Languages. London: Routledge. 
  • Posner, Rebecca (1996). The Romance Languages. Cambridge: Cambridge University Press. 
  • Alkire, Ti; Rosen, Carol (2010). Romance Languages: A Historical Introduction. Cambridge: Cambridge University Press. 

Sound Changes:

  • Boyd-Bowman, Peter (1980). From Latin to Romance in Sound Charts. Washington, D.C.: Georgetown University Press. 

Lexicon:

  • Holtus, Günter; Metzeltin, Michael; Schmitt, Christian (1988–1005). Lexikon der Romanistischen Linguistik. (LRL, 12 volumes). Tübingen: Niemeyer. 

French:

  • Price, Glanville (1971). The French language: present and past. Edward Arnold. 
  • Kibler, William W. (1984). An introduction to Old French. New York: Modern Language Association of America. 

Portuguese:

  • Williams, Edwin B. (1968). From Latin to Portuguese, Historical Phonology and Morphology of the Portuguese Language (2nd ed.). University of Pennsylvania. 

Spanish:

  • Penny, Ralph (2002). A History of the Spanish Language (2nd ed.). Cambridge: Cambridge University Press. 
  • Lapesa, Rafael (1981). Historia de la Lengua Española. Madrid: Editorial Gredos. 
  • Vicente, Alonso Zamora (1967). Dialectología Española (2nd ed.). Madrid: Editorial Gredos. 

Italian:

  • Devoto, Giacomo; Giacomelli, Gabriella (2002). I Dialetti delle Regioni d'Italia (3rd ed.). Milano: RCS Libri (Tascabili Bompiani). 
  • Devoto, Giacomo (1999). Il Linguaggio d'Italia. Milano: RCS Libri (Biblioteca Universale Rizzoli). 

External links

Romance languages
 
Gallo-Rhaetian




 
Italics indicate extinct languages; bold indicates languages with more than 5 million speakers; languages between parentheses are HTML5 of the language on their left.


[1] Search
[2] All Pages
[3] Random article
powered by FITML